Incidental Mutation 'R7507:Zfp260'
ID581846
Institutional Source Beutler Lab
Gene Symbol Zfp260
Ensembl Gene ENSMUSG00000049421
Gene Namezinc finger protein 260
SynonymsZfp63, PEX1, Ozrf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30094777-30107622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30104866 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 64 (S64P)
Ref Sequence ENSEMBL: ENSMUSP00000052200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050735] [ENSMUST00000108200] [ENSMUST00000130526]
Predicted Effect probably damaging
Transcript: ENSMUST00000050735
AA Change: S64P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052200
Gene: ENSMUSG00000049421
AA Change: S64P

DomainStartEndE-ValueType
ZnF_C2H2 23 45 6.78e-3 SMART
ZnF_C2H2 51 71 2.44e2 SMART
ZnF_C2H2 79 101 3.21e-4 SMART
ZnF_C2H2 131 153 5.59e-4 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 9.88e-5 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 1.6e-4 SMART
ZnF_C2H2 271 293 8.94e-3 SMART
ZnF_C2H2 299 321 3.21e-4 SMART
ZnF_C2H2 327 349 9.88e-5 SMART
ZnF_C2H2 355 377 1.38e-3 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108200
AA Change: S64P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103835
Gene: ENSMUSG00000049421
AA Change: S64P

DomainStartEndE-ValueType
ZnF_C2H2 23 45 6.78e-3 SMART
ZnF_C2H2 51 71 2.44e2 SMART
ZnF_C2H2 79 101 3.21e-4 SMART
ZnF_C2H2 131 153 5.59e-4 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 9.88e-5 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 1.6e-4 SMART
ZnF_C2H2 271 293 8.94e-3 SMART
ZnF_C2H2 299 321 3.21e-4 SMART
ZnF_C2H2 327 349 9.88e-5 SMART
ZnF_C2H2 355 377 1.38e-3 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130526
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Zfp260
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1739:Zfp260 UTSW 7 30104806 missense probably benign 0.04
R2143:Zfp260 UTSW 7 30105340 missense probably damaging 1.00
R2144:Zfp260 UTSW 7 30105340 missense probably damaging 1.00
R2145:Zfp260 UTSW 7 30105340 missense probably damaging 1.00
R2400:Zfp260 UTSW 7 30104701 missense possibly damaging 0.83
R3802:Zfp260 UTSW 7 30105079 missense probably benign 0.01
R5250:Zfp260 UTSW 7 30104967 missense probably damaging 1.00
R6313:Zfp260 UTSW 7 30104842 missense possibly damaging 0.86
R6416:Zfp260 UTSW 7 30104810 missense possibly damaging 0.58
R7369:Zfp260 UTSW 7 30105325 missense probably damaging 1.00
R7920:Zfp260 UTSW 7 30105592 nonsense probably null
R8531:Zfp260 UTSW 7 30105459 missense probably damaging 1.00
R8868:Zfp260 UTSW 7 30105489 nonsense probably null
Z1186:Zfp260 UTSW 7 30105038 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGTCTCAGTAGATGCTAGGAG -3'
(R):5'- TAACGGTGGTTGTCATGGGAAC -3'

Sequencing Primer
(F):5'- CCCCTGTGCAGATCAGAATGTTG -3'
(R):5'- ACGGGAGTTTTCTTAGATTCACTG -3'
Posted On2019-10-17