Incidental Mutation 'R7507:Plppr4'
ID581835
Institutional Source Beutler Lab
Gene Symbol Plppr4
Ensembl Gene ENSMUSG00000044667
Gene Namephospholipid phosphatase related 4
SynonymsLppr4, D3Bwg0562e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location117319139-117360876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117322105 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 701 (H701L)
Ref Sequence ENSEMBL: ENSMUSP00000052306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061071] [ENSMUST00000197743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061071
AA Change: H701L

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052306
Gene: ENSMUSG00000044667
AA Change: H701L

DomainStartEndE-ValueType
acidPPc 180 324 4.07e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197743
AA Change: H643L

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143753
Gene: ENSMUSG00000044667
AA Change: H643L

DomainStartEndE-ValueType
SCOP:d1d2ta_ 59 268 1e-7 SMART
Blast:acidPPc 180 265 8e-53 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, seizures, hyperexcitability of evoked fEPSP, and premature lethality around 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Plppr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plppr4 APN 3 117322220 missense probably benign 0.01
IGL01969:Plppr4 APN 3 117328359 missense probably damaging 1.00
IGL02014:Plppr4 APN 3 117335573 missense probably damaging 1.00
IGL02068:Plppr4 APN 3 117331784 splice site probably benign
IGL02426:Plppr4 APN 3 117322295 missense probably benign 0.01
IGL03203:Plppr4 APN 3 117325891 missense possibly damaging 0.89
PIT4445001:Plppr4 UTSW 3 117360308 unclassified probably benign
R0376:Plppr4 UTSW 3 117323091 missense probably benign 0.05
R0755:Plppr4 UTSW 3 117322670 missense possibly damaging 0.68
R0831:Plppr4 UTSW 3 117331646 critical splice donor site probably null
R1518:Plppr4 UTSW 3 117335503 missense probably damaging 1.00
R1523:Plppr4 UTSW 3 117322841 missense probably damaging 1.00
R1581:Plppr4 UTSW 3 117328266 missense possibly damaging 0.58
R1628:Plppr4 UTSW 3 117328272 missense probably damaging 1.00
R2510:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R2511:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R4332:Plppr4 UTSW 3 117322825 missense probably benign
R4380:Plppr4 UTSW 3 117322397 missense probably benign 0.40
R4787:Plppr4 UTSW 3 117322330 missense probably damaging 0.99
R4829:Plppr4 UTSW 3 117335591 missense possibly damaging 0.94
R5511:Plppr4 UTSW 3 117325902 missense probably benign 0.39
R5819:Plppr4 UTSW 3 117325864 missense possibly damaging 0.89
R6149:Plppr4 UTSW 3 117322394 missense probably benign 0.22
R6257:Plppr4 UTSW 3 117322579 missense possibly damaging 0.49
R6974:Plppr4 UTSW 3 117323018 missense probably damaging 1.00
R7045:Plppr4 UTSW 3 117360034 missense probably damaging 1.00
R7102:Plppr4 UTSW 3 117323183 missense probably damaging 0.98
R7820:Plppr4 UTSW 3 117321949 missense possibly damaging 0.88
R8179:Plppr4 UTSW 3 117331678 missense probably damaging 1.00
R8181:Plppr4 UTSW 3 117322465 missense probably damaging 1.00
R8391:Plppr4 UTSW 3 117335411 missense probably benign 0.02
R8531:Plppr4 UTSW 3 117321943 missense probably damaging 1.00
R8762:Plppr4 UTSW 3 117325833 missense probably damaging 1.00
R8784:Plppr4 UTSW 3 117322541 nonsense probably null
Z1176:Plppr4 UTSW 3 117322849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCCTTATAAGCCCGCGTGG -3'
(R):5'- CCATCATTCAGATCCCGTCG -3'

Sequencing Primer
(F):5'- GGGGAGGTTCCTTTGTAGAAGATG -3'
(R):5'- AGATCCCGTCGTCCACTGAG -3'
Posted On2019-10-17