Incidental Mutation 'R0620:Ect2'
ID 58582
Institutional Source Beutler Lab
Gene Symbol Ect2
Ensembl Gene ENSMUSG00000027699
Gene Name ect2 oncogene
Synonyms
MMRRC Submission 038809-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0620 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 27097222-27153878 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27139652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 226 (A226T)
Ref Sequence ENSEMBL: ENSMUSP00000135740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108298] [ENSMUST00000108300] [ENSMUST00000176242] [ENSMUST00000184113]
AlphaFold Q07139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108296
Predicted Effect probably damaging
Transcript: ENSMUST00000108298
AA Change: A226T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103933
Gene: ENSMUSG00000027699
AA Change: A226T

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108300
AA Change: A257T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103935
Gene: ENSMUSG00000027699
AA Change: A257T

DomainStartEndE-ValueType
BRCT 174 250 1.45e-10 SMART
BRCT 268 344 2.52e-10 SMART
low complexity region 362 372 N/A INTRINSIC
RhoGEF 456 640 3.22e-67 SMART
Blast:PH 667 794 1e-80 BLAST
low complexity region 856 870 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124727
Predicted Effect probably damaging
Transcript: ENSMUST00000176242
AA Change: A226T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135740
Gene: ENSMUSG00000027699
AA Change: A226T

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184113
Meta Mutation Damage Score 0.5495 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor and transforming protein that is related to Rho-specific exchange factors and yeast cell cycle regulators. The expression of this gene is elevated with the onset of DNA synthesis and remains elevated during G2 and M phases. In situ hybridization analysis showed that expression is at a high level in cells undergoing mitosis in regenerating liver. Thus, this protein is expressed in a cell cycle-dependent manner during liver regeneration, and is thought to have an important role in the regulation of cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Homozygous disruption of this locus is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,375 Q973L probably damaging Het
Adamts9 T C 6: 92,858,113 T679A possibly damaging Het
Ahr T C 12: 35,508,194 T276A probably benign Het
Akap9 A T 5: 4,064,136 Q3138H probably damaging Het
Armt1 T A 10: 4,432,689 F7I probably benign Het
B3galt2 A G 1: 143,646,140 R5G probably damaging Het
Bod1l T C 5: 41,801,233 N2750S probably benign Het
Cadps2 T A 6: 23,583,396 E365V probably damaging Het
Cd200r3 T A 16: 44,957,717 probably null Het
Cst7 T A 2: 150,575,886 probably benign Het
Defb30 A T 14: 63,049,763 probably benign Het
Dido1 C T 2: 180,659,851 G2087S probably benign Het
Dio2 A G 12: 90,738,071 Y72H probably benign Het
Dnah11 C T 12: 117,987,469 E3035K probably damaging Het
Dnajb13 T C 7: 100,503,249 K287E possibly damaging Het
Dnajc11 G A 4: 151,973,628 V244I possibly damaging Het
Ercc8 G A 13: 108,174,061 probably null Het
Fam120b T A 17: 15,402,927 M389K probably benign Het
Fam151a A G 4: 106,747,931 M497V probably benign Het
Fam186b C A 15: 99,280,128 G439V probably benign Het
Fank1 A G 7: 133,876,765 Y185C probably damaging Het
Gart T C 16: 91,630,602 probably benign Het
Glb1l T C 1: 75,199,720 Y572C probably damaging Het
Gm11563 C T 11: 99,658,437 A164T unknown Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gsdmc3 T A 15: 63,859,693 D330V probably damaging Het
H2-DMa C T 17: 34,137,960 T144M probably damaging Het
Haus6 A T 4: 86,583,514 F707I possibly damaging Het
Hmcn1 T A 1: 150,594,016 T4971S probably benign Het
Ints6 A T 14: 62,696,759 F766L probably benign Het
Kdm5d T A Y: 927,330 M650K probably damaging Het
Kif21b T C 1: 136,159,428 F881S possibly damaging Het
Klrk1 C A 6: 129,614,635 Q176H possibly damaging Het
Ky T C 9: 102,537,621 V244A probably benign Het
Mia2 T A 12: 59,154,419 L191M possibly damaging Het
Miga2 T A 2: 30,381,744 probably benign Het
Mtss1l C T 8: 110,737,948 P322S probably damaging Het
Nalcn A G 14: 123,299,141 probably benign Het
Ncbp3 T A 11: 73,049,845 probably benign Het
Nprl3 G A 11: 32,234,876 L378F probably damaging Het
Ntrk2 A T 13: 58,846,821 M184L probably benign Het
Olfr311 T G 11: 58,841,443 C110G probably damaging Het
Olfr738 G T 14: 50,413,697 C51F probably benign Het
Osbpl9 T C 4: 109,083,128 E287G probably damaging Het
Parva T C 7: 112,576,411 F250L probably damaging Het
Pcdhb11 C T 18: 37,421,811 Q65* probably null Het
Phtf1 A G 3: 103,993,765 T377A probably damaging Het
Pkp4 G A 2: 59,322,643 V612I possibly damaging Het
Plscr2 C A 9: 92,287,654 S52R probably benign Het
Pnisr C T 4: 21,874,092 probably benign Het
Pole2 A C 12: 69,209,879 S291A probably damaging Het
Ppp2r5d A G 17: 46,684,018 F586L probably benign Het
Prrx1 G A 1: 163,257,816 R182C probably damaging Het
Ptprs A G 17: 56,429,103 I110T possibly damaging Het
Rasgrf2 G A 13: 91,919,817 probably benign Het
Riox2 T C 16: 59,491,892 V464A probably benign Het
Robo2 A G 16: 73,967,802 V646A possibly damaging Het
Ros1 T A 10: 52,118,348 I1279F probably damaging Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Snx7 T C 3: 117,846,675 N62D probably damaging Het
Sp100 G A 1: 85,659,867 probably null Het
Stil A T 4: 115,007,159 I86L possibly damaging Het
Tbc1d16 T A 11: 119,209,038 D170V probably benign Het
Tmem2 T A 19: 21,817,971 S743T probably benign Het
Trappc13 G A 13: 104,161,081 T105M probably damaging Het
Trhr T A 15: 44,229,500 S378T probably benign Het
Ttc7b T C 12: 100,500,073 probably null Het
Vegfc A T 8: 54,157,139 Y110F probably benign Het
Vmn1r184 C A 7: 26,267,177 P116H possibly damaging Het
Vmn2r5 A T 3: 64,503,814 C444* probably null Het
Zfp341 A G 2: 154,634,273 E460G possibly damaging Het
Zfp819 T A 7: 43,616,444 V41E probably benign Het
Other mutations in Ect2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ect2 APN 3 27138669 missense probably benign 0.04
IGL00770:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL00774:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL01414:Ect2 APN 3 27127729 splice site probably benign
IGL02017:Ect2 APN 3 27122044 nonsense probably null
IGL02318:Ect2 APN 3 27138719 missense probably benign 0.16
IGL02395:Ect2 APN 3 27150106 missense probably damaging 1.00
IGL03109:Ect2 APN 3 27144972 missense possibly damaging 0.88
IGL03178:Ect2 APN 3 27148860 missense probably benign 0.03
IGL03055:Ect2 UTSW 3 27137062 missense probably damaging 1.00
PIT4504001:Ect2 UTSW 3 27126948 nonsense probably null
R0090:Ect2 UTSW 3 27115476 missense probably benign 0.00
R0090:Ect2 UTSW 3 27138502 missense probably null 0.08
R0436:Ect2 UTSW 3 27150095 missense probably benign 0.11
R1847:Ect2 UTSW 3 27150072 missense probably benign 0.01
R2404:Ect2 UTSW 3 27131850 missense probably benign 0.00
R3890:Ect2 UTSW 3 27138540 missense probably damaging 1.00
R3951:Ect2 UTSW 3 27130120 missense probably benign 0.00
R4588:Ect2 UTSW 3 27147000 missense probably damaging 1.00
R4754:Ect2 UTSW 3 27126963 missense probably damaging 1.00
R5051:Ect2 UTSW 3 27102486 missense probably benign
R5254:Ect2 UTSW 3 27130070 missense probably damaging 1.00
R5415:Ect2 UTSW 3 27146853 missense probably damaging 1.00
R5786:Ect2 UTSW 3 27146953 missense probably damaging 1.00
R5940:Ect2 UTSW 3 27115465 missense probably benign 0.01
R5974:Ect2 UTSW 3 27144963 nonsense probably null
R6012:Ect2 UTSW 3 27098325 utr 3 prime probably benign
R6434:Ect2 UTSW 3 27139119 nonsense probably null
R6447:Ect2 UTSW 3 27115484 missense probably damaging 1.00
R6850:Ect2 UTSW 3 27138885 missense probably damaging 1.00
R6989:Ect2 UTSW 3 27102488 nonsense probably null
R7147:Ect2 UTSW 3 27150090 missense probably benign 0.12
R7257:Ect2 UTSW 3 27138535 missense probably damaging 1.00
R7417:Ect2 UTSW 3 27098419 missense probably damaging 1.00
R7564:Ect2 UTSW 3 27116123 intron probably benign
R7662:Ect2 UTSW 3 27131798 missense probably damaging 0.99
R8720:Ect2 UTSW 3 27115498 missense probably damaging 0.98
R8886:Ect2 UTSW 3 27145977 unclassified probably benign
R8967:Ect2 UTSW 3 27144983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTCATCCCCAACTGGTAAATAGC -3'
(R):5'- TTCTACTAAGCAGCATCCTGGGCG -3'

Sequencing Primer
(F):5'- gtaagccacagcaggaaaag -3'
(R):5'- GGCGACCTCCTCTTTTACTAAAC -3'
Posted On 2013-07-11