Incidental Mutation 'R7720:Gipr'
ID595170
Institutional Source Beutler Lab
Gene Symbol Gipr
Ensembl Gene ENSMUSG00000030406
Gene Namegastric inhibitory polypeptide receptor
SynonymsLOC232937, glucose-dependent insulinotropic polypeptide receptor, LOC381853
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19156061-19166127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19162959 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 129 (I129V)
Ref Sequence ENSEMBL: ENSMUSP00000092384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094790] [ENSMUST00000206971]
Predicted Effect probably benign
Transcript: ENSMUST00000094790
AA Change: I129V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092384
Gene: ENSMUSG00000030406
AA Change: I129V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
HormR 53 123 6.14e-23 SMART
Pfam:7tm_2 130 384 1.3e-81 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000206971
AA Change: *141W
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor for gastric inhibitory polypeptide (GIP), which was originally identified as an activity in gut extracts that inhibited gastric acid secretion and gastrin release, but subsequently was demonstrated to stimulate insulin release in the presence of elevated glucose. Mice lacking this gene exhibit higher blood glucose levels with impaired initial insulin response after oral glucose load. Defect in this gene thus may contribute to the pathogenesis of diabetes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this gene results in mild glucose intolerance due to impaired glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Lman2 A T 13: 55,353,077 probably null Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Gipr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Gipr APN 7 19159506 unclassified probably benign
IGL02214:Gipr APN 7 19157546 missense possibly damaging 0.46
IGL02525:Gipr APN 7 19159765 missense possibly damaging 0.64
IGL03163:Gipr APN 7 19162556 nonsense probably null
PIT4449001:Gipr UTSW 7 19160618 missense probably benign 0.05
PIT4480001:Gipr UTSW 7 19162934 missense probably damaging 1.00
R1813:Gipr UTSW 7 19164071 missense probably benign 0.02
R1896:Gipr UTSW 7 19164071 missense probably benign 0.02
R3409:Gipr UTSW 7 19159794 missense possibly damaging 0.74
R3949:Gipr UTSW 7 19157429 missense probably benign 0.00
R4781:Gipr UTSW 7 19157375 missense possibly damaging 0.95
R4841:Gipr UTSW 7 19162676 missense probably damaging 1.00
R4842:Gipr UTSW 7 19162676 missense probably damaging 1.00
R5087:Gipr UTSW 7 19159764 missense probably damaging 1.00
R5297:Gipr UTSW 7 19157544 missense probably damaging 1.00
R5480:Gipr UTSW 7 19160654 missense probably damaging 1.00
R5763:Gipr UTSW 7 19163550 missense probably damaging 0.99
R6957:Gipr UTSW 7 19164604 missense probably benign 0.01
R7035:Gipr UTSW 7 19162884 missense probably damaging 1.00
R7254:Gipr UTSW 7 19163613 missense probably damaging 1.00
Z1177:Gipr UTSW 7 19157565 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AAAGCTGTCCTCAGGCATCC -3'
(R):5'- CTTAAAGAAGTACAAGTGGAGCTTC -3'

Sequencing Primer
(F):5'- AGGCATCCAACGTCCCTTG -3'
(R):5'- CAAGGAGAAAACAGGCAATTTTTAGC -3'
Posted On2019-11-12