Mutagenetix > Incidental Mutation

Incidental Mutation 'R7720:Nol4'

595199

Institutional Source

Beutler Lab

Gene Symbol

Nol4

Ensembl Gene

ENSMUSG00000041923

Gene Name

nucleolar protein 4

Synonyms

4930568N03Rik, 1700013J13Rik, LOC383304

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.504) question?

Stock #

R7720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22693181-23041653 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23040023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 7 (M7K)

Ref Sequence

ENSEMBL: ENSMUSP00000095256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081423] [ENSMUST00000097651] [ENSMUST00000164186] [ENSMUST00000164893] [ENSMUST00000165323]

AlphaFold

P60954

Predicted Effect

probably benign
Transcript: ENSMUST00000081423

SMART Domains

Protein: ENSMUSP00000080150
Gene: ENSMUSG00000041923

Domain	Start	End	E-Value	Type
low complexity region	139	155	N/A	INTRINSIC
low complexity region	199	210	N/A	INTRINSIC
low complexity region	309	320	N/A	INTRINSIC
low complexity region	487	506	N/A	INTRINSIC
low complexity region	513	523	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097651
AA Change: M7K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000095256
Gene: ENSMUSG00000041923
AA Change: M7K

Domain	Start	End	E-Value	Type
low complexity region	212	228	N/A	INTRINSIC
low complexity region	272	283	N/A	INTRINSIC
low complexity region	382	393	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164186
AA Change: M7K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130950
Gene: ENSMUSG00000041923
AA Change: M7K

Domain	Start	End	E-Value	Type
low complexity region	212	228	N/A	INTRINSIC
low complexity region	272	283	N/A	INTRINSIC
low complexity region	382	393	N/A	INTRINSIC
low complexity region	560	579	N/A	INTRINSIC
low complexity region	586	596	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164893
AA Change: M7K

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000127870
Gene: ENSMUSG00000041923
AA Change: M7K

Domain	Start	End	E-Value	Type
low complexity region	212	228	N/A	INTRINSIC
low complexity region	272	283	N/A	INTRINSIC
low complexity region	382	393	N/A	INTRINSIC
low complexity region	496	515	N/A	INTRINSIC
low complexity region	522	532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165323

SMART Domains

Protein: ENSMUSP00000125860
Gene: ENSMUSG00000041923

Domain	Start	End	E-Value	Type
low complexity region	95	108	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,843,102	C148S	probably damaging	Het
4921530L21Rik	A	G	14: 95,882,112	R102G	probably benign	Het
A230050P20Rik	C	T	9: 20,868,859		probably benign	Het
Agap2	A	G	10: 127,091,088	D1018G	probably damaging	Het
Atm	T	C	9: 53,522,239	N237S	possibly damaging	Het
Card6	G	T	15: 5,098,423	Q1164K	unknown	Het
Cped1	G	A	6: 22,222,431	C730Y	probably damaging	Het
Csmd1	A	T	8: 15,931,108	L2770Q	probably damaging	Het
Ctsw	T	C	19: 5,467,044	T87A	probably damaging	Het
Dock4	T	C	12: 40,806,975	I1269T	probably damaging	Het
F11	T	C	8: 45,252,090	E138G	possibly damaging	Het
Fam124b	A	G	1: 80,200,257	S342P	probably damaging	Het
Fam71d	T	C	12: 78,712,133	S76P	probably damaging	Het
Gipr	T	C	7: 19,162,959	I129V	probably benign	Het
Gm5415	T	C	1: 32,546,097	D244G	probably benign	Het
Gria4	A	T	9: 4,464,288	V558D	probably damaging	Het
Gsdme	C	T	6: 50,229,308	G185E	probably damaging	Het
Hgd	T	A	16: 37,593,435	D86E	probably benign	Het
Hmcn1	T	A	1: 150,646,709	H3480L	probably benign	Het
Hs2st1	T	C	3: 144,454,022	N127D	probably damaging	Het
Ilf3	A	G	9: 21,399,537	N599S	possibly damaging	Het
Itsn1	G	A	16: 91,868,083	G1132R	unknown	Het
Jakmip2	A	G	18: 43,571,908	S343P	possibly damaging	Het
Kif1b	A	G	4: 149,182,355	V1670A	probably benign	Het
Lman2	A	T	13: 55,353,077		probably null	Het
Ltbp1	A	T	17: 75,385,124	Y1579F	probably damaging	Het
Mon2	G	A	10: 123,032,588	A520V	probably benign	Het
Mrpl10	T	G	11: 97,047,537	V171G	possibly damaging	Het
Mrps27	A	T	13: 99,401,330	T153S	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nlrp10	A	G	7: 108,924,488	V595A	probably benign	Het
Oasl1	G	A	5: 114,929,921	S188N	probably damaging	Het
Olfr193	T	C	16: 59,109,771	I280V	probably benign	Het
Olfr709-ps1	C	A	7: 106,927,411	G16V	probably benign	Het
Pcdhga2	A	G	18: 37,669,940	Y279C	probably damaging	Het
Pfpl	C	T	19: 12,429,174	A263V	probably benign	Het
Phf3	T	G	1: 30,829,857	K703N	probably damaging	Het
Pik3ca	C	G	3: 32,436,218	P5A	probably damaging	Het
Plekha6	T	C	1: 133,293,707	V987A	probably damaging	Het
Ppp3ca	T	A	3: 136,890,489	I305N	probably damaging	Het
Prex2	A	G	1: 11,181,937	K1069E	possibly damaging	Het
Prss50	T	C	9: 110,861,335	V182A	probably damaging	Het
Ptprg	A	G	14: 12,211,703	N995S	probably benign	Het
Robo2	C	A	16: 73,897,015	G1375V	probably benign	Het
Rtl1	T	C	12: 109,594,430	Y325C	possibly damaging	Het
Shcbp1	A	C	8: 4,748,720	S400A	probably damaging	Het
Sirpb1c	T	A	3: 15,832,072	Y380F	probably benign	Het
Tbl2	G	C	5: 135,159,475	L374F	probably damaging	Het
Tpr	C	A	1: 150,429,532	A1524E	possibly damaging	Het
Vmn2r45	T	A	7: 8,483,461	E276V	probably damaging	Het
Vps16	C	T	2: 130,441,703	Q606*	probably null	Het
Vstm5	A	T	9: 15,239,356	Q29L	probably benign	Het
Wipi1	G	T	11: 109,582,423	S250Y	probably damaging	Het

Other mutations in Nol4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Nol4	APN	18	22823412	missense	probably benign	0.15
IGL00677:Nol4	APN	18	22921867	missense	probably damaging	1.00
IGL01153:Nol4	APN	18	22769793	missense	probably damaging	1.00
IGL01400:Nol4	APN	18	22823498	missense	probably damaging	0.99
IGL02006:Nol4	APN	18	22921918	missense	probably damaging	1.00
IGL02342:Nol4	APN	18	22770869	splice site	probably benign
IGL02501:Nol4	APN	18	22823341	missense	probably damaging	1.00
PIT4378001:Nol4	UTSW	18	23039876	missense	probably damaging	1.00
R0096:Nol4	UTSW	18	22921858	missense	possibly damaging	0.95
R0097:Nol4	UTSW	18	22719141	missense	probably benign	0.23
R0097:Nol4	UTSW	18	22719141	missense	probably benign	0.23
R1257:Nol4	UTSW	18	22770681	missense	probably damaging	1.00
R1793:Nol4	UTSW	18	22769821	missense	probably damaging	1.00
R2101:Nol4	UTSW	18	22823409	missense	probably damaging	1.00
R2357:Nol4	UTSW	18	23039910	missense	probably benign	0.01
R2414:Nol4	UTSW	18	22823572	critical splice acceptor site	probably null
R2427:Nol4	UTSW	18	22850698	intron	probably benign
R3713:Nol4	UTSW	18	23039937	missense	probably damaging	1.00
R3734:Nol4	UTSW	18	22770864	splice site	probably benign
R3803:Nol4	UTSW	18	22694955	missense	probably damaging	1.00
R4458:Nol4	UTSW	18	22751995	missense	probably damaging	0.99
R4736:Nol4	UTSW	18	22718993	missense	probably damaging	1.00
R4774:Nol4	UTSW	18	22912626	missense	probably damaging	0.96
R4795:Nol4	UTSW	18	22921887	missense	probably damaging	1.00
R5245:Nol4	UTSW	18	22695122	makesense	probably null
R5980:Nol4	UTSW	18	22952201	missense	probably damaging	0.97
R6372:Nol4	UTSW	18	23038556	critical splice donor site	probably null
R6485:Nol4	UTSW	18	22770793	missense	probably damaging	1.00
R6614:Nol4	UTSW	18	22920856	missense	probably damaging	1.00
R6809:Nol4	UTSW	18	22920825	missense	probably damaging	1.00
R6877:Nol4	UTSW	18	22719129	missense	probably benign	0.06
R7269:Nol4	UTSW	18	23039789	missense	probably benign
R7310:Nol4	UTSW	18	22770744	missense
R7753:Nol4	UTSW	18	23038602	start codon destroyed	probably benign	0.15
R7897:Nol4	UTSW	18	22823343	missense
R7974:Nol4	UTSW	18	22719025	nonsense	probably null
R8297:Nol4	UTSW	18	23040012	missense	probably damaging	0.99
R8303:Nol4	UTSW	18	23040174	unclassified	probably benign
R8466:Nol4	UTSW	18	23038581	missense	probably benign	0.03
R8985:Nol4	UTSW	18	22952237	missense	probably damaging	1.00
R9064:Nol4	UTSW	18	22770793	missense
R9296:Nol4	UTSW	18	22823331	missense
R9442:Nol4	UTSW	18	22769842	missense	probably damaging	1.00
R9456:Nol4	UTSW	18	23039840	missense	probably benign	0.41
R9469:Nol4	UTSW	18	22952261	missense	probably damaging	0.99
R9478:Nol4	UTSW	18	22920877	missense	probably damaging	1.00
R9708:Nol4	UTSW	18	22694996	missense	probably damaging	1.00
Z1088:Nol4	UTSW	18	22921902	missense	probably damaging	1.00
Z1177:Nol4	UTSW	18	22769840	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGAAACCCTTCGATTTGACCC -3'
(R):5'- AACGAGCCAGACTTGGTAGC -3'

Sequencing Primer
(F):5'- CCAGAATTTAAATTTGGCATTGTCGG -3'
(R):5'- ATTGATTGCTGGTGCCCATC -3'

Posted On

2019-11-12