Incidental Mutation 'R7737:Klhl14'
ID596348
Institutional Source Beutler Lab
Gene Symbol Klhl14
Ensembl Gene ENSMUSG00000042514
Gene Namekelch-like 14
Synonymsprintor, 6330403N15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location21550377-21654718 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 21558134 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 446 (Y446*)
Ref Sequence ENSEMBL: ENSMUSP00000042015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]
Predicted Effect probably null
Transcript: ENSMUST00000049105
AA Change: Y446*
SMART Domains Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: Y446*

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122333
AA Change: Y446*
SMART Domains Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: Y446*

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Klhl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Klhl14 APN 18 21651864 missense probably benign 0.00
IGL01474:Klhl14 APN 18 21557854 missense probably damaging 0.99
IGL02005:Klhl14 APN 18 21624611 nonsense probably null
IGL02108:Klhl14 APN 18 21557920 missense probably damaging 0.98
IGL02371:Klhl14 APN 18 21652181 missense probably damaging 1.00
IGL03354:Klhl14 APN 18 21651728 missense probably damaging 1.00
P0027:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
PIT4810001:Klhl14 UTSW 18 21557823 nonsense probably null
R0288:Klhl14 UTSW 18 21565563 missense probably damaging 1.00
R1419:Klhl14 UTSW 18 21652193 missense probably damaging 0.99
R1606:Klhl14 UTSW 18 21565532 missense possibly damaging 0.94
R1771:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R1928:Klhl14 UTSW 18 21651786 missense probably damaging 1.00
R1966:Klhl14 UTSW 18 21554673 missense probably damaging 1.00
R3624:Klhl14 UTSW 18 21557896 missense probably damaging 1.00
R4541:Klhl14 UTSW 18 21554639 nonsense probably null
R4664:Klhl14 UTSW 18 21554708 missense probably benign 0.06
R4856:Klhl14 UTSW 18 21557972 intron probably null
R4886:Klhl14 UTSW 18 21557972 intron probably null
R4893:Klhl14 UTSW 18 21557935 missense probably damaging 1.00
R5393:Klhl14 UTSW 18 21651994 missense probably benign 0.30
R5757:Klhl14 UTSW 18 21554734 missense probably damaging 1.00
R5951:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R5958:Klhl14 UTSW 18 21565535 missense probably damaging 0.99
R7231:Klhl14 UTSW 18 21652136 missense probably damaging 0.99
R7519:Klhl14 UTSW 18 21651843 missense probably benign 0.36
R7527:Klhl14 UTSW 18 21651540 missense probably damaging 0.99
R7573:Klhl14 UTSW 18 21652154 missense probably benign 0.00
R7664:Klhl14 UTSW 18 21554649 missense probably damaging 1.00
R8079:Klhl14 UTSW 18 21651965 missense probably benign 0.39
T0722:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
X0026:Klhl14 UTSW 18 21651941 missense possibly damaging 0.94
Z1177:Klhl14 UTSW 18 21652104 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACAACCATGGGACGTACTCTC -3'
(R):5'- GAGACACCCTGCTTTCACAG -3'

Sequencing Primer
(F):5'- CATGGGACGTACTCTCCGTTG -3'
(R):5'- TGCTTTCACAGGCAGATCG -3'
Posted On2019-11-26