Incidental Mutation 'R7737:Adamts18'
ID 628459
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms E130314N14Rik
MMRRC Submission 045793-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R7737 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 114423758-114575370 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 114463566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
AlphaFold Q4VC17
Predicted Effect probably null
Transcript: ENSMUST00000093113
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap3 T A 6: 126,851,065 (GRCm39) M861K probably damaging Het
Ankrd42 T C 7: 92,254,470 (GRCm39) T380A possibly damaging Het
Arhgef5 A G 6: 43,250,728 (GRCm39) E493G possibly damaging Het
Arvcf G A 16: 18,214,966 (GRCm39) R119Q probably damaging Het
Asmt T C X: 169,110,175 (GRCm39) F228S probably damaging Het
Atp2c2 T A 8: 120,469,134 (GRCm39) V349E probably damaging Het
BC034090 A G 1: 155,117,419 (GRCm39) V233A possibly damaging Het
Brinp3 G T 1: 146,558,332 (GRCm39) K85N probably damaging Het
Ccr6 G A 17: 8,463,926 (GRCm39) probably benign Het
D7Ertd443e A G 7: 133,871,930 (GRCm39) S644P probably damaging Het
Ddb1 C T 19: 10,603,338 (GRCm39) A882V possibly damaging Het
Epha4 C T 1: 77,357,649 (GRCm39) G783D probably damaging Het
Ephb1 T A 9: 101,861,302 (GRCm39) I621F probably damaging Het
Fbxw18 G T 9: 109,530,331 (GRCm39) Y93* probably null Het
Fcgbpl1 T A 7: 27,856,498 (GRCm39) V2095E probably damaging Het
Gak A C 5: 108,764,874 (GRCm39) L84R probably benign Het
Gm5458 A T 14: 19,649,805 (GRCm39) probably null Het
Gpatch3 C G 4: 133,302,407 (GRCm39) Q113E probably benign Het
Gpld1 C A 13: 25,159,709 (GRCm39) L426M probably damaging Het
Ighmbp2 G A 19: 3,324,467 (GRCm39) P234S unknown Het
Itga6 G A 2: 71,652,787 (GRCm39) V217I probably benign Het
Kdm7a A T 6: 39,121,338 (GRCm39) N872K probably benign Het
Klhl14 G T 18: 21,691,191 (GRCm39) Y446* probably null Het
Larp4b T A 13: 9,220,679 (GRCm39) probably null Het
Lct A T 1: 128,226,430 (GRCm39) W1320R probably benign Het
Lrp2 T C 2: 69,326,782 (GRCm39) D1763G possibly damaging Het
Lrrk2 A T 15: 91,699,649 (GRCm39) N2499Y probably damaging Het
Lsg1 T C 16: 30,400,003 (GRCm39) probably null Het
Mettl15 T C 2: 108,967,723 (GRCm39) K188E probably damaging Het
Mfsd4b1 A G 10: 39,879,274 (GRCm39) S208P probably damaging Het
Mlxipl T C 5: 135,164,235 (GRCm39) S793P possibly damaging Het
Ms4a14 G A 19: 11,280,150 (GRCm39) Q803* probably null Het
Mtor A C 4: 148,623,195 (GRCm39) E2015A possibly damaging Het
Myo15b A T 11: 115,778,749 (GRCm39) Y2581F unknown Het
Myo7b A T 18: 32,147,257 (GRCm39) Y95* probably null Het
Nf1 A G 11: 79,436,314 (GRCm39) I1985V probably benign Het
Noxred1 G A 12: 87,268,136 (GRCm39) Q332* probably null Het
Nudt21 A T 8: 94,749,461 (GRCm39) Y202N probably damaging Het
Odad2 A G 18: 7,217,890 (GRCm39) L608P probably damaging Het
Or1j16 A T 2: 36,530,632 (GRCm39) I194F probably benign Het
Pik3c2a A T 7: 115,955,488 (GRCm39) S1176T probably damaging Het
Pramel14 A C 4: 143,718,526 (GRCm39) S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Rbmxl1 A G 8: 79,232,252 (GRCm39) S364P unknown Het
Rnf24 T A 2: 131,145,416 (GRCm39) K131N probably benign Het
Scai T A 2: 39,013,034 (GRCm39) Q132L probably damaging Het
Sh3tc1 T C 5: 35,881,297 (GRCm39) R49G probably benign Het
Slc12a7 A G 13: 73,936,796 (GRCm39) E152G probably benign Het
Slc22a27 A T 19: 7,874,127 (GRCm39) M316K probably damaging Het
Spag1 G T 15: 36,210,856 (GRCm39) A427S probably benign Het
Speer4a3 AACT A 5: 26,155,849 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk16 G T 1: 75,187,995 (GRCm39) C8F probably damaging Het
Syne2 T C 12: 75,989,622 (GRCm39) C1834R probably damaging Het
Tie1 C T 4: 118,336,054 (GRCm39) probably null Het
Timp2 A G 11: 118,194,721 (GRCm39) I156T probably damaging Het
Tmem163 A G 1: 127,419,347 (GRCm39) M286T possibly damaging Het
Tmx4 T A 2: 134,481,588 (GRCm39) M112L probably benign Het
Trank1 G T 9: 111,195,080 (GRCm39) E1035* probably null Het
Trim5 C T 7: 103,928,771 (GRCm39) V57M probably damaging Het
Ubr3 A G 2: 69,821,910 (GRCm39) S1391G probably benign Het
Vmn1r72 A T 7: 11,403,634 (GRCm39) S271R probably damaging Het
Xpo5 G A 17: 46,547,016 (GRCm39) probably null Het
Zfp592 A T 7: 80,674,941 (GRCm39) H635L probably damaging Het
Zfp791 A T 8: 85,838,844 (GRCm39) N62K probably benign Het
Zfp998 A G 13: 66,581,738 (GRCm39) probably null Het
Zmynd11 G A 13: 9,745,175 (GRCm39) T248M probably damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 114,501,575 (GRCm39) missense probably damaging 1.00
IGL01548:Adamts18 APN 8 114,490,931 (GRCm39) missense probably damaging 1.00
IGL01556:Adamts18 APN 8 114,571,741 (GRCm39) missense probably benign 0.01
IGL01833:Adamts18 APN 8 114,469,728 (GRCm39) missense probably benign 0.10
IGL02187:Adamts18 APN 8 114,439,826 (GRCm39) missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 114,425,704 (GRCm39) missense probably damaging 1.00
IGL02756:Adamts18 APN 8 114,440,976 (GRCm39) splice site probably benign
IGL03188:Adamts18 APN 8 114,425,656 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts18 APN 8 114,490,929 (GRCm39) nonsense probably null
G1patch:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R0119:Adamts18 UTSW 8 114,501,585 (GRCm39) missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 114,469,749 (GRCm39) missense probably damaging 1.00
R0410:Adamts18 UTSW 8 114,440,990 (GRCm39) nonsense probably null
R0480:Adamts18 UTSW 8 114,465,450 (GRCm39) missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 114,465,401 (GRCm39) splice site probably null
R0924:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R0930:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R1333:Adamts18 UTSW 8 114,431,805 (GRCm39) splice site probably benign
R1441:Adamts18 UTSW 8 114,481,194 (GRCm39) critical splice donor site probably null
R2082:Adamts18 UTSW 8 114,501,965 (GRCm39) missense probably damaging 1.00
R2146:Adamts18 UTSW 8 114,571,635 (GRCm39) missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 114,431,893 (GRCm39) missense probably benign 0.36
R3148:Adamts18 UTSW 8 114,465,490 (GRCm39) missense probably damaging 1.00
R3963:Adamts18 UTSW 8 114,504,443 (GRCm39) missense probably benign 0.00
R4056:Adamts18 UTSW 8 114,464,212 (GRCm39) nonsense probably null
R4486:Adamts18 UTSW 8 114,439,825 (GRCm39) missense probably benign 0.00
R4608:Adamts18 UTSW 8 114,464,245 (GRCm39) missense probably damaging 1.00
R4624:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4626:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4627:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4628:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4629:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4710:Adamts18 UTSW 8 114,433,558 (GRCm39) missense probably damaging 0.98
R4959:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4973:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4976:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5119:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5141:Adamts18 UTSW 8 114,501,902 (GRCm39) missense probably damaging 1.00
R5422:Adamts18 UTSW 8 114,425,606 (GRCm39) missense probably benign 0.06
R5587:Adamts18 UTSW 8 114,501,992 (GRCm39) nonsense probably null
R5868:Adamts18 UTSW 8 114,504,380 (GRCm39) missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 114,499,709 (GRCm39) missense probably damaging 1.00
R5906:Adamts18 UTSW 8 114,436,251 (GRCm39) missense probably benign 0.00
R5942:Adamts18 UTSW 8 114,504,380 (GRCm39) missense probably benign 0.01
R6006:Adamts18 UTSW 8 114,433,606 (GRCm39) missense probably damaging 1.00
R6608:Adamts18 UTSW 8 114,501,911 (GRCm39) missense probably damaging 1.00
R6725:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R7002:Adamts18 UTSW 8 114,501,922 (GRCm39) missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 114,501,896 (GRCm39) missense probably damaging 0.99
R7292:Adamts18 UTSW 8 114,436,277 (GRCm39) missense probably benign 0.00
R7411:Adamts18 UTSW 8 114,504,362 (GRCm39) missense probably damaging 0.99
R7685:Adamts18 UTSW 8 114,439,855 (GRCm39) missense probably damaging 1.00
R7860:Adamts18 UTSW 8 114,501,908 (GRCm39) missense probably damaging 1.00
R7936:Adamts18 UTSW 8 114,493,760 (GRCm39) missense probably damaging 1.00
R8197:Adamts18 UTSW 8 114,481,227 (GRCm39) missense probably damaging 1.00
R8363:Adamts18 UTSW 8 114,493,795 (GRCm39) missense probably damaging 1.00
R8759:Adamts18 UTSW 8 114,433,624 (GRCm39) missense probably damaging 1.00
R8934:Adamts18 UTSW 8 114,463,510 (GRCm39) missense possibly damaging 0.90
R9405:Adamts18 UTSW 8 114,430,030 (GRCm39) missense probably damaging 1.00
R9422:Adamts18 UTSW 8 114,501,910 (GRCm39) missense probably damaging 1.00
R9450:Adamts18 UTSW 8 114,490,942 (GRCm39) missense probably benign 0.10
R9475:Adamts18 UTSW 8 114,504,570 (GRCm39) missense possibly damaging 0.93
Z1088:Adamts18 UTSW 8 114,502,072 (GRCm39) missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 114,469,800 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TATTCAAACGTGGTCCCTGCG -3'
(R):5'- GTGCATACAAAAGCACACATACTGG -3'

Sequencing Primer
(F):5'- TCCCTGCGAAGGTGAAGTC -3'
(R):5'- TACAAAAGCACACATACTGGGAGAG -3'
Posted On 2020-04-20