Mutagenetix > Incidental Mutation

Incidental Mutation 'R7737:Ubr3'

596303

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

045793-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7737 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69991566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1391 (S1391G)

Ref Sequence

ENSEMBL: ENSMUSP00000060159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251] [ENSMUST00000152610]

AlphaFold

Q5U430

Predicted Effect

probably benign
Transcript: ENSMUST00000055758
AA Change: S1391G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: S1391G

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112251
AA Change: S1390G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: S1390G

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152610
AA Change: S85G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000122027
Gene: ENSMUSG00000044308
AA Change: S85G

Domain	Start	End	E-Value	Type
Blast:RING	1	57	1e-34	BLAST
SCOP:d1jm7a_	20	84	4e-3	SMART

Meta Mutation Damage Score

0.0637

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,677		probably null	Het
9530053A07Rik	T	A	7: 28,157,073	V2095E	probably damaging	Het
Adamts18	A	T	8: 113,736,934		probably null	Het
Akap3	T	A	6: 126,874,102	M861K	probably damaging	Het
Ankrd42	T	C	7: 92,605,262	T380A	possibly damaging	Het
Arhgef5	A	G	6: 43,273,794	E493G	possibly damaging	Het
Armc4	A	G	18: 7,217,890	L608P	probably damaging	Het
Arvcf	G	A	16: 18,397,101	R119Q	probably damaging	Het
Asmt	T	C	X: 170,676,440	F228S	probably damaging	Het
Atp2c2	T	A	8: 119,742,395	V349E	probably damaging	Het
BC034090	A	G	1: 155,241,673	V233A	possibly damaging	Het
Brinp3	G	T	1: 146,682,594	K85N	probably damaging	Het
Ccr6	G	A	17: 8,245,094		probably benign	Het
D7Ertd443e	A	G	7: 134,270,201	S644P	probably damaging	Het
Ddb1	C	T	19: 10,625,974	A882V	possibly damaging	Het
Epha4	C	T	1: 77,381,012	G783D	probably damaging	Het
Ephb1	T	A	9: 101,984,103	I621F	probably damaging	Het
Fbxw18	G	T	9: 109,701,263	Y93*	probably null	Het
Gak	A	C	5: 108,617,008	L84R	probably benign	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Gm5458	A	T	14: 19,599,737		probably null	Het
Gpatch3	C	G	4: 133,575,096	Q113E	probably benign	Het
Gpld1	C	A	13: 24,975,726	L426M	probably damaging	Het
Ighmbp2	G	A	19: 3,274,467	P234S	unknown	Het
Itga6	G	A	2: 71,822,443	V217I	probably benign	Het
Kdm7a	A	T	6: 39,144,404	N872K	probably benign	Het
Klhl14	G	T	18: 21,558,134	Y446*	probably null	Het
Larp4b	T	A	13: 9,170,643		probably null	Het
Lct	A	T	1: 128,298,693	W1320R	probably benign	Het
Lrp2	T	C	2: 69,496,438	D1763G	possibly damaging	Het
Lrrk2	A	T	15: 91,815,446	N2499Y	probably damaging	Het
Lsg1	T	C	16: 30,581,185		probably null	Het
Mettl15	T	C	2: 109,137,378	K188E	probably damaging	Het
Mfsd4b1	A	G	10: 40,003,278	S208P	probably damaging	Het
Mlxipl	T	C	5: 135,135,381	S793P	possibly damaging	Het
Ms4a14	G	A	19: 11,302,786	Q803*	probably null	Het
Mtor	A	C	4: 148,538,738	E2015A	possibly damaging	Het
Myo15b	A	T	11: 115,887,923	Y2581F	unknown	Het
Myo7b	A	T	18: 32,014,204	Y95*	probably null	Het
Nf1	A	G	11: 79,545,488	I1985V	probably benign	Het
Noxred1	G	A	12: 87,221,362	Q332*	probably null	Het
Nudt21	A	T	8: 94,022,833	Y202N	probably damaging	Het
Olfr345	A	T	2: 36,640,620	I194F	probably benign	Het
Pik3c2a	A	T	7: 116,356,253	S1176T	probably damaging	Het
Pramef17	A	C	4: 143,991,956	S306A	possibly damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Rbmxl1	A	G	8: 78,505,623	S364P	unknown	Het
Rnf24	T	A	2: 131,303,496	K131N	probably benign	Het
Scai	T	A	2: 39,123,022	Q132L	probably damaging	Het
Sh3tc1	T	C	5: 35,723,953	R49G	probably benign	Het
Slc12a7	A	G	13: 73,788,677	E152G	probably benign	Het
Slc22a27	A	T	19: 7,896,762	M316K	probably damaging	Het
Spag1	G	T	15: 36,210,710	A427S	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stk16	G	T	1: 75,211,351	C8F	probably damaging	Het
Syne2	T	C	12: 75,942,848	C1834R	probably damaging	Het
Tie1	C	T	4: 118,478,857		probably null	Het
Timp2	A	G	11: 118,303,895	I156T	probably damaging	Het
Tmem163	A	G	1: 127,491,610	M286T	possibly damaging	Het
Tmx4	T	A	2: 134,639,668	M112L	probably benign	Het
Trank1	G	T	9: 111,366,012	E1035*	probably null	Het
Trim5	C	T	7: 104,279,564	V57M	probably damaging	Het
Vmn1r72	A	T	7: 11,669,707	S271R	probably damaging	Het
Xpo5	G	A	17: 46,236,090		probably null	Het
Zfp592	A	T	7: 81,025,193	H635L	probably damaging	Het
Zfp791	A	T	8: 85,112,215	N62K	probably benign	Het
Zmynd11	G	A	13: 9,695,139	T248M	probably damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
R8675:Ubr3	UTSW	2	70020521	missense	probably damaging	1.00
R8834:Ubr3	UTSW	2	70003441	missense	probably benign
R8975:Ubr3	UTSW	2	69922307	missense	probably damaging	1.00
R9060:Ubr3	UTSW	2	70009145	nonsense	probably null
R9153:Ubr3	UTSW	2	69965478	missense
R9234:Ubr3	UTSW	2	69897646	missense	probably benign
R9293:Ubr3	UTSW	2	69897425	missense	probably benign	0.02
R9312:Ubr3	UTSW	2	69954333	missense	probably damaging	1.00
R9710:Ubr3	UTSW	2	69897613	missense	possibly damaging	0.94
R9762:Ubr3	UTSW	2	70009153	missense	probably benign	0.00
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGTGCCTTGTTAACCATTGATG -3'
(R):5'- AAGGCCCAGGGTAACTTAGG -3'

Sequencing Primer
(F):5'- ATGTGTGAATCAGATCTCTCTCTG -3'
(R):5'- CGGTAGGAAGTAGGGAAGAGATG -3'

Posted On

2019-11-26