Incidental Mutation 'R7807:Pcsk9'
ID600849
Institutional Source Beutler Lab
Gene Symbol Pcsk9
Ensembl Gene ENSMUSG00000044254
Gene Nameproprotein convertase subtilisin/kexin type 9
SynonymsNarc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106442329-106464329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106463895 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 6 (S6P)
Ref Sequence ENSEMBL: ENSMUSP00000055757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049507
AA Change: S6P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Peptidase_S8 180 438 3.1e-34 PFAM
low complexity region 471 481 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an autocatalytic processing event with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. It is expressed in liver, intestine and kidney tissues and escorts specific receptors for lysosomal degradation. It plays a role in cholesterol and fatty acid metabolism. Mutations in this gene have been associated with autosomal dominant familial hypercholesterolemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice exhibit increased clearance of circulating cholesterol and decreased plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Pcsk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Pcsk9 APN 4 106454646 missense probably benign 0.00
IGL02709:Pcsk9 APN 4 106447689 splice site probably benign
IGL02804:Pcsk9 APN 4 106456964 missense probably damaging 1.00
IGL02850:Pcsk9 APN 4 106458865 missense probably damaging 1.00
IGL03009:Pcsk9 APN 4 106454345 missense probably damaging 1.00
IGL03294:Pcsk9 APN 4 106446770 missense probably benign
R0271:Pcsk9 UTSW 4 106449049 splice site probably benign
R0321:Pcsk9 UTSW 4 106444694 missense probably benign
R0413:Pcsk9 UTSW 4 106454341 missense probably damaging 1.00
R0426:Pcsk9 UTSW 4 106450077 missense possibly damaging 0.77
R0783:Pcsk9 UTSW 4 106450117 missense probably benign 0.00
R2136:Pcsk9 UTSW 4 106446770 missense probably benign 0.00
R4056:Pcsk9 UTSW 4 106444702 missense probably benign 0.02
R4438:Pcsk9 UTSW 4 106458959 missense probably benign 0.00
R4683:Pcsk9 UTSW 4 106458895 missense possibly damaging 0.59
R4739:Pcsk9 UTSW 4 106447156 missense probably damaging 1.00
R4801:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R4802:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R5249:Pcsk9 UTSW 4 106463753 missense probably benign 0.01
R5307:Pcsk9 UTSW 4 106447174 missense probably damaging 1.00
R5320:Pcsk9 UTSW 4 106463791 missense probably benign 0.00
R5653:Pcsk9 UTSW 4 106458916 missense probably damaging 1.00
R5827:Pcsk9 UTSW 4 106448947 missense probably damaging 1.00
R6010:Pcsk9 UTSW 4 106454272 missense possibly damaging 0.92
R6019:Pcsk9 UTSW 4 106456876 missense probably benign 0.02
R6393:Pcsk9 UTSW 4 106447596 missense probably benign 0.00
R7472:Pcsk9 UTSW 4 106458897 missense probably benign 0.08
R7614:Pcsk9 UTSW 4 106447566 missense probably benign 0.34
R8036:Pcsk9 UTSW 4 106454339 missense possibly damaging 0.88
R8735:Pcsk9 UTSW 4 106454611 missense probably damaging 1.00
Z1176:Pcsk9 UTSW 4 106458941 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTAGAGACCACCAGACGG -3'
(R):5'- ATCAGAGAGGATCTTCCGATGG -3'

Sequencing Primer
(F):5'- ATACCTTGGAGCAACGGC -3'
(R):5'- AGGATCTTCCGATGGGGCTC -3'
Posted On2019-11-26