Incidental Mutation 'R7807:Pikfyve'
ID 600836
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms Pip5k3
MMRRC Submission 045862-MU
Accession Numbers

Genbank: NM_011086

Essential gene? Essential (E-score: 1.000) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 65186683-65278695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65269942 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1893 (Y1893C)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1848C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1848C

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: Y1893C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1893C

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Meta Mutation Damage Score 0.9551 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7961:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65265789 missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65246395 missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65253342 splice site probably benign
R8307:Pikfyve UTSW 1 65245735 missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65215996 missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65244417 missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65271268 missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65246970 missense probably benign 0.00
R8995:Pikfyve UTSW 1 65205587 critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65244400 missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65246080 missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65196739 missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65260029 missense probably benign 0.37
R9368:Pikfyve UTSW 1 65268742 missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65264402 missense probably benign
R9605:Pikfyve UTSW 1 65264402 missense probably benign
R9686:Pikfyve UTSW 1 65252456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTTGAAACAGGAAATAAACA -3'
(R):5'- TGTGACCTGCTCTTACCAGA -3'

Sequencing Primer
(F):5'- AGACGATTTGGAGTCTGGAATG -3'
(R):5'- GAGACAGCTAGATCAGAGTCCTTTC -3'
Posted On 2019-11-26