Incidental Mutation 'R8026:Vmn2r61'
ID617706
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8026 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42266717 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 251 (N251K)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect probably benign
Transcript: ENSMUST00000166131
AA Change: N251K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: N251K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,406,725 V513A probably damaging Het
Acsf2 C T 11: 94,562,888 V416M probably damaging Het
Adrm1 G A 2: 180,175,209 A225T unknown Het
Aldh9a1 T C 1: 167,352,667 probably null Het
Apbb2 T C 5: 66,451,644 D220G probably benign Het
B230118H07Rik A T 2: 101,570,644 probably benign Het
Bace2 T C 16: 97,436,852 V501A probably benign Het
Camsap1 T C 2: 25,938,202 N1170S probably benign Het
Casr A G 16: 36,495,617 V697A probably damaging Het
Clcn1 T C 6: 42,307,661 probably null Het
Cobl T C 11: 12,253,459 K1081R probably benign Het
Ctr9 T A 7: 111,033,892 L116I probably damaging Het
Dennd4a T C 9: 64,873,030 F616S probably damaging Het
Dynlt1a C T 17: 6,311,814 G30S possibly damaging Het
Eif1 T C 11: 100,320,448 S23P possibly damaging Het
Eml6 A C 11: 29,749,973 L1721R possibly damaging Het
Fscb A G 12: 64,474,275 I139T probably benign Het
Fstl4 A G 11: 53,068,669 E179G probably damaging Het
Fuom T C 7: 140,100,154 T95A Het
Gigyf1 C T 5: 137,525,478 H1001Y probably damaging Het
Gm21886 T A 18: 80,089,746 S66C probably damaging Het
Helz2 G A 2: 181,240,205 T265I probably benign Het
Hs6st3 G T 14: 119,869,556 V459F probably damaging Het
Ido2 A G 8: 24,535,140 probably null Het
Idua A G 5: 108,670,249 I96V probably benign Het
Inpp5j A G 11: 3,495,171 S494P Het
Krt19 A G 11: 100,141,383 V285A probably damaging Het
Krt71 T G 15: 101,738,382 D297A possibly damaging Het
L3hypdh G A 12: 72,084,949 R70C probably damaging Het
Masp1 T C 16: 23,484,406 Y324C probably damaging Het
Mfap2 A G 4: 141,013,803 D25G possibly damaging Het
Mmp17 G A 5: 129,595,084 probably null Het
Mroh7 G A 4: 106,721,437 P15S probably benign Het
Muc5b T A 7: 141,863,636 C3440S probably benign Het
Naip5 C A 13: 100,245,898 S101I probably damaging Het
Neb A T 2: 52,223,048 Y1066N Het
Nop56 T A 2: 130,277,268 C38S probably benign Het
Nup214 T A 2: 32,033,350 L1297Q possibly damaging Het
Oasl2 C A 5: 114,902,268 probably benign Het
Olfr1242 A G 2: 89,493,788 F175L probably damaging Het
Olfr192 T C 16: 59,098,368 H208R unknown Het
Olfr48 T C 2: 89,844,929 N15D probably benign Het
Olfr66 A G 7: 103,881,697 V182A possibly damaging Het
Olfr68 T A 7: 103,778,340 I2F probably benign Het
Olfr967 T C 9: 39,750,796 S137P possibly damaging Het
Pacrg C T 17: 10,576,567 V155I probably benign Het
Patz1 A T 11: 3,307,658 M96L probably benign Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Ptprr A G 10: 116,048,170 Y44C probably damaging Het
Rad51ap1 A G 6: 126,934,712 probably null Het
Raet1e A C 10: 22,181,299 D174A probably damaging Het
Rhobtb2 T G 14: 69,796,765 D337A probably benign Het
Sbf2 T C 7: 110,335,387 K1377E probably damaging Het
Sh3pxd2b A G 11: 32,411,567 K260E probably damaging Het
Slc4a8 A T 15: 100,787,289 I234F possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tbxas1 C T 6: 39,027,896 T359I probably benign Het
Trim9 T A 12: 70,290,387 S309C probably benign Het
Ttn G A 2: 76,829,139 P12191S unknown Het
Unc80 A G 1: 66,483,304 R222G possibly damaging Het
Vmn1r202 A T 13: 22,502,144 H34Q possibly damaging Het
Vmn2r67 A T 7: 85,136,716 Y694N probably damaging Het
Vwde A G 6: 13,205,783 F255S probably benign Het
Zfp532 T G 18: 65,625,156 I720R possibly damaging Het
Zfp819 A G 7: 43,617,895 T601A probably benign Het
Zfp853 G T 5: 143,288,525 Q462K unknown Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 42300517 missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 42300697 missense probably benign
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 42266643 missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42267253 missense probably benign 0.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 42266491 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 42260110 missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
R7839:Vmn2r61 UTSW 7 42266608 missense probably damaging 0.97
R7916:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Z1176:Vmn2r61 UTSW 7 42260161 missense possibly damaging 0.46
Z1176:Vmn2r61 UTSW 7 42266742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTATCCTGAATGAACGAGGTCAG -3'
(R):5'- GTATCAACATCCCATGAAGAGGTC -3'

Sequencing Primer
(F):5'- TCTGTATCAGATGGCCCCCAAG -3'
(R):5'- GGTCAAGACCCAGACTTTCCATG -3'
Posted On2020-01-23