Incidental Mutation 'R7789:Boll'
ID 628630
Institutional Source Beutler Lab
Gene Symbol Boll
Ensembl Gene ENSMUSG00000025977
Gene Name boule homolog, RNA binding protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 55248658-55363469 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 55360667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087585] [ENSMUST00000114423] [ENSMUST00000159398] [ENSMUST00000159564] [ENSMUST00000173983]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000087585
SMART Domains Protein: ENSMUSP00000084868
Gene: ENSMUSG00000025977

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
RRM 46 118 1.09e-24 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
low complexity region 271 287 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114423
SMART Domains Protein: ENSMUSP00000110066
Gene: ENSMUSG00000025977

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
low complexity region 51 67 N/A INTRINSIC
low complexity region 138 154 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159398
SMART Domains Protein: ENSMUSP00000123814
Gene: ENSMUSG00000025977

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
RRM 46 118 1.09e-24 SMART
Predicted Effect silent
Transcript: ENSMUST00000159564
SMART Domains Protein: ENSMUSP00000124962
Gene: ENSMUSG00000025977

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:RRM_1 47 87 2.7e-12 PFAM
Pfam:RRM_6 47 87 4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173983
SMART Domains Protein: ENSMUSP00000134054
Gene: ENSMUSG00000025977

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RRM 33 105 1.09e-24 SMART
low complexity region 153 167 N/A INTRINSIC
low complexity region 171 187 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the DAZ gene family required for germ cell development. It encodes an RNA-binding protein which is more similar to Drosophila Boule than to human proteins encoded by genes DAZ (deleted in azoospermia) or DAZL (deleted in azoospermia-like). Loss of this gene function results in the absence of sperm in semen (azoospermia). Histological studies demonstrated that the primary defect is at the meiotic G2/M transition. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility due to arrested spermatogenesis at step 6 in spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Boll
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Boll APN 1 55305668 splice site probably benign
IGL01575:Boll APN 1 55323648 critical splice donor site probably null
R2849:Boll UTSW 1 55346373 missense possibly damaging 0.53
R5030:Boll UTSW 1 55355735 missense probably damaging 1.00
R6150:Boll UTSW 1 55270653 missense possibly damaging 0.86
R7325:Boll UTSW 1 55304598 missense probably damaging 1.00
R7455:Boll UTSW 1 55300103 missense probably benign 0.18
R8046:Boll UTSW 1 55346403 missense probably damaging 0.98
R8073:Boll UTSW 1 55355722 start gained probably benign
R8181:Boll UTSW 1 55363319 start codon destroyed probably benign
R8377:Boll UTSW 1 55323678 missense possibly damaging 0.89
R9276:Boll UTSW 1 55360653 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGACCACAAGGGCTTTTAAATTATC -3'
(R):5'- GCCTAAATGACAGCTTTGATGATC -3'

Sequencing Primer
(F):5'- TTTAAACCAATGCAATGTGAAACCC -3'
(R):5'- ACCCAGTGCTAAAAGCAT -3'
Posted On 2020-06-01