Incidental Mutation 'R7789:Fam196b'
ID599756
Institutional Source Beutler Lab
Gene Symbol Fam196b
Ensembl Gene ENSMUSG00000069911
Gene Namefamily with sequence similarity 196, member B
SynonymsGm6041
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7789 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location34314822-34422640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34402537 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 193 (M193K)
Ref Sequence ENSEMBL: ENSMUSP00000090883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101364] [ENSMUST00000101365] [ENSMUST00000165963]
Predicted Effect probably benign
Transcript: ENSMUST00000093192
AA Change: M193K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911
AA Change: M193K

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101364
Predicted Effect probably benign
Transcript: ENSMUST00000101365
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165963
AA Change: M193K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911
AA Change: M193K

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Fam196b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Fam196b APN 11 34403011 missense probably benign
IGL01867:Fam196b APN 11 34403065 missense probably benign 0.39
PIT4677001:Fam196b UTSW 11 34403122 missense probably benign
R0317:Fam196b UTSW 11 34402826 missense possibly damaging 0.94
R1165:Fam196b UTSW 11 34402740 missense probably benign
R1710:Fam196b UTSW 11 34404263 splice site probably null
R2083:Fam196b UTSW 11 34402141 missense probably benign 0.01
R2096:Fam196b UTSW 11 34402936 missense probably benign 0.03
R3820:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3821:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3822:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3969:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3970:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3980:Fam196b UTSW 11 34402678 missense probably benign 0.00
R4092:Fam196b UTSW 11 34401935 start gained probably benign
R4231:Fam196b UTSW 11 34403143 missense probably benign 0.01
R4678:Fam196b UTSW 11 34403227 missense probably damaging 1.00
R4859:Fam196b UTSW 11 34403154 missense probably benign 0.31
R4938:Fam196b UTSW 11 34402231 missense probably damaging 0.98
R5269:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5287:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5358:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5359:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5361:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5362:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5363:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5403:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5705:Fam196b UTSW 11 34404349 missense probably damaging 1.00
R6282:Fam196b UTSW 11 34402819 missense possibly damaging 0.77
R7030:Fam196b UTSW 11 34402030 missense probably damaging 0.96
R7069:Fam196b UTSW 11 34402677 missense possibly damaging 0.48
R7178:Fam196b UTSW 11 34402359 missense probably damaging 0.96
R7180:Fam196b UTSW 11 34419873 missense probably damaging 1.00
R7718:Fam196b UTSW 11 34402539 missense probably benign 0.00
R7832:Fam196b UTSW 11 34403034 missense probably benign
R8377:Fam196b UTSW 11 34401964 missense probably damaging 1.00
Z1177:Fam196b UTSW 11 34402725 missense probably benign 0.01
Z1177:Fam196b UTSW 11 34403188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCAACCTATCTGAACAGG -3'
(R):5'- TGTGCCCGGCATATTACTGG -3'

Sequencing Primer
(F):5'- GAACAGGATATTGTGTCCTCTGACC -3'
(R):5'- CGGCATATTACTGGCACTGC -3'
Posted On2019-11-26