Incidental Mutation 'R7789:Lcat'
ID 599745
Institutional Source Beutler Lab
Gene Symbol Lcat
Ensembl Gene ENSMUSG00000035237
Gene Name lecithin cholesterol acyltransferase
Synonyms D8Wsu61e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105939551-105943382 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105942225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 114 (V114M)
Ref Sequence ENSEMBL: ENSMUSP00000038232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034369] [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]
AlphaFold P16301
Predicted Effect probably benign
Transcript: ENSMUST00000034369
SMART Domains Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897

DomainStartEndE-ValueType
Pfam:Proteasome 36 217 3.9e-49 PFAM
Pfam:Pr_beta_C 231 267 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034370
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038896
AA Change: V114M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237
AA Change: V114M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116429
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes display severe hypoalphalipoproteinemia, variable hypertriglyceridemia, and accumulation of heterogeneous pre-beta HDL, as well as an attenuated increase in apoB-containing lipoproteins in response to dietary cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Lcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02494:Lcat APN 8 105941939 unclassified probably benign
IGL02654:Lcat APN 8 105939769 missense possibly damaging 0.68
IGL02678:Lcat APN 8 105941940 splice site probably null
IGL02963:Lcat APN 8 105939956 missense probably damaging 0.99
IGL03304:Lcat APN 8 105940063 missense possibly damaging 0.94
R1754:Lcat UTSW 8 105941814 frame shift probably null
R1757:Lcat UTSW 8 105941814 frame shift probably null
R1824:Lcat UTSW 8 105939888 missense probably damaging 0.98
R1962:Lcat UTSW 8 105941723 missense probably damaging 0.98
R2866:Lcat UTSW 8 105939879 missense probably damaging 0.98
R4091:Lcat UTSW 8 105939906 missense probably benign 0.09
R4172:Lcat UTSW 8 105942427 missense possibly damaging 0.56
R4921:Lcat UTSW 8 105942442 missense possibly damaging 0.92
R5487:Lcat UTSW 8 105939664 missense probably benign
R6552:Lcat UTSW 8 105939679 missense possibly damaging 0.58
R7096:Lcat UTSW 8 105939677 missense possibly damaging 0.76
R8338:Lcat UTSW 8 105940087 missense probably damaging 1.00
R8773:Lcat UTSW 8 105940078 missense possibly damaging 0.68
R8775:Lcat UTSW 8 105942391 missense possibly damaging 0.52
R8775-TAIL:Lcat UTSW 8 105942391 missense possibly damaging 0.52
R8814:Lcat UTSW 8 105941970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGATTCTGCACCAGTGTG -3'
(R):5'- ACAGAGGACTTCTTCACCATC -3'

Sequencing Primer
(F):5'- ACCAGTGTGTGCAGGTAGC -3'
(R):5'- ACCATCTGGCTGGATTTCAAC -3'
Posted On 2019-11-26