Incidental Mutation 'R7789:Usp7'
ID599765
Institutional Source Beutler Lab
Gene Symbol Usp7
Ensembl Gene ENSMUSG00000022710
Gene Nameubiquitin specific peptidase 7
Synonyms2210010O09Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7789 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location8689595-8792308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8698811 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 539 (Q539L)
Ref Sequence ENSEMBL: ENSMUSP00000124093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160326] [ENSMUST00000160405] [ENSMUST00000161046] [ENSMUST00000172505]
Predicted Effect probably benign
Transcript: ENSMUST00000160326
SMART Domains Protein: ENSMUSP00000124576
Gene: ENSMUSG00000022710

DomainStartEndE-ValueType
PDB:2F1Z|B 43 83 2e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160405
AA Change: Q579L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124382
Gene: ENSMUSG00000022710
AA Change: Q579L

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
MATH 111 217 4.27e-22 SMART
Pfam:UCH 254 559 5.7e-53 PFAM
Pfam:UCH_1 255 528 3.7e-22 PFAM
Pfam:USP7_ICP0_bdg 661 906 7.1e-79 PFAM
Pfam:USP7_C2 916 1127 4.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161046
AA Change: Q539L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124093
Gene: ENSMUSG00000022710
AA Change: Q539L

DomainStartEndE-ValueType
MATH 71 177 4.27e-22 SMART
Pfam:UCH 214 519 9.6e-60 PFAM
Pfam:UCH_1 215 488 5.1e-29 PFAM
Pfam:USP7_ICP0_bdg 620 866 5e-83 PFAM
Pfam:USP7_C2 875 1089 2.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172505
SMART Domains Protein: ENSMUSP00000133398
Gene: ENSMUSG00000022710

DomainStartEndE-ValueType
Pfam:UCH_1 5 247 1.7e-18 PFAM
Pfam:UCH 5 278 2.8e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C19 family, which includes ubiquitinyl hydrolases. This protein deubiquitinates target proteins such as p53 (a tumor suppressor protein) and WASH (essential for endosomal protein recycling), and regulates their activities by counteracting the opposing ubiquitin ligase activity of proteins such as HDM2 and TRIM27, involved in the respective process. Mutations in this gene have been implicated in a neurodevelopmental disorder. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic growth arrest and die between E6.5 and E7.5. Mice homozygous for a conditional allele activated in neural cells exhibit complete neonatal lethality, absent gastric milk, uncoordinated movement and abnormalforebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Usp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Usp7 APN 16 8697975 missense probably damaging 0.96
IGL00496:Usp7 APN 16 8695113 missense probably damaging 0.99
IGL02113:Usp7 APN 16 8716513 critical splice donor site probably null
IGL02873:Usp7 APN 16 8695194 unclassified probably benign
IGL03036:Usp7 APN 16 8738214 missense probably benign 0.00
PIT4402001:Usp7 UTSW 16 8698495 missense probably benign
R0066:Usp7 UTSW 16 8691418 missense probably benign
R0400:Usp7 UTSW 16 8716632 splice site probably benign
R0483:Usp7 UTSW 16 8699262 missense probably damaging 1.00
R0625:Usp7 UTSW 16 8704982 missense probably benign 0.00
R0626:Usp7 UTSW 16 8693914 missense possibly damaging 0.54
R0837:Usp7 UTSW 16 8703502 missense probably damaging 1.00
R0967:Usp7 UTSW 16 8696654 unclassified probably benign
R1929:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2270:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2271:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2272:Usp7 UTSW 16 8698469 missense probably benign 0.00
R3949:Usp7 UTSW 16 8716564 missense probably damaging 1.00
R4411:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4413:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4500:Usp7 UTSW 16 8695895 missense possibly damaging 0.89
R4651:Usp7 UTSW 16 8698414 intron probably benign
R4852:Usp7 UTSW 16 8756844 nonsense probably null
R5483:Usp7 UTSW 16 8698540 missense probably benign
R5610:Usp7 UTSW 16 8716510 splice site probably null
R5734:Usp7 UTSW 16 8701981 missense possibly damaging 0.91
R5964:Usp7 UTSW 16 8712102 missense possibly damaging 0.52
R6753:Usp7 UTSW 16 8696911 missense probably benign 0.25
R7171:Usp7 UTSW 16 8716526 missense probably benign 0.01
R7263:Usp7 UTSW 16 8696724 missense possibly damaging 0.89
R7420:Usp7 UTSW 16 8710121 missense probably benign
R7654:Usp7 UTSW 16 8702043 missense probably benign 0.33
R7808:Usp7 UTSW 16 8705163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCTGAAGGCATAGAAAGCTGAG -3'
(R):5'- CAAGCTGTGCTACGCTTGTG -3'

Sequencing Primer
(F):5'- GCTGAGCTTACAACCACTCAG -3'
(R):5'- TGCTACGCTTGTGGGCTCC -3'
Posted On2019-11-26