Incidental Mutation 'R7789:Zyg11a'
ID 599718
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Name zyg-11 family member A, cell cycle regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 108181738-108218048 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108183648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 703 (P703S)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000052999] [ENSMUST00000106690] [ENSMUST00000116307] [ENSMUST00000116309] [ENSMUST00000125647] [ENSMUST00000126900] [ENSMUST00000130942] [ENSMUST00000223127]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043793
AA Change: P701S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645
AA Change: P701S

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000052999
SMART Domains Protein: ENSMUSP00000051268
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 41 296 1.1e-60 PFAM
Pfam:ECH_2 46 225 5.1e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106690
AA Change: P703S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645
AA Change: P703S

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106691
SMART Domains Protein: ENSMUSP00000102302
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 119 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116307
SMART Domains Protein: ENSMUSP00000112009
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 131 6.7e-17 PFAM
Pfam:ECH 124 257 5.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116309
SMART Domains Protein: ENSMUSP00000112011
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 288 3.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125647
SMART Domains Protein: ENSMUSP00000123913
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126900
Predicted Effect probably benign
Transcript: ENSMUST00000130942
SMART Domains Protein: ENSMUSP00000124746
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 103 8.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135718
SMART Domains Protein: ENSMUSP00000114371
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 74 9.6e-16 PFAM
Pfam:ECH_2 2 74 1.1e-11 PFAM
Pfam:ECH_1 69 184 2.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223127
AA Change: P703S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0610:Zyg11a UTSW 4 108204857 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R3898:Zyg11a UTSW 4 108210194 missense probably damaging 0.99
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4381:Zyg11a UTSW 4 108201320 missense possibly damaging 0.58
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5349:Zyg11a UTSW 4 108183732 missense probably damaging 1.00
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6254:Zyg11a UTSW 4 108181794 missense probably damaging 1.00
R6678:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R7524:Zyg11a UTSW 4 108192074 missense probably damaging 1.00
R8022:Zyg11a UTSW 4 108189568 critical splice donor site probably null
R8437:Zyg11a UTSW 4 108217906 missense probably damaging 1.00
R8986:Zyg11a UTSW 4 108184431 critical splice donor site probably null
R9129:Zyg11a UTSW 4 108181812 missense probably benign 0.00
R9383:Zyg11a UTSW 4 108189729 missense probably damaging 1.00
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Z1176:Zyg11a UTSW 4 108201282 missense probably damaging 1.00
Z1177:Zyg11a UTSW 4 108204800 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTTATCTCTCTTGACCAAGGAAAG -3'
(R):5'- ACTGCATAGTACATCTGTCTCTG -3'

Sequencing Primer
(F):5'- AATTACTGTGTAGCCCAGGC -3'
(R):5'- GCATAGTACATCTGTCTCTGTAGAAC -3'
Posted On 2019-11-26