Incidental Mutation 'R7789:Sema3f'
ID599750
Institutional Source Beutler Lab
Gene Symbol Sema3f
Ensembl Gene ENSMUSG00000034684
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
SynonymsSema IV, Semak
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7789 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107681500-107710475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107705432 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 37 (K37N)
Ref Sequence ENSEMBL: ENSMUSP00000141865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080560] [ENSMUST00000192727] [ENSMUST00000193108] [ENSMUST00000194039]
Predicted Effect probably benign
Transcript: ENSMUST00000080560
AA Change: K37N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684
AA Change: K37N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192727
AA Change: K37N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141865
Gene: ENSMUSG00000034684
AA Change: K37N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 529 3.31e-205 SMART
PSI 547 599 1.87e-12 SMART
IGc2 617 685 3.79e-4 SMART
low complexity region 704 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193108
AA Change: K37N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141878
Gene: ENSMUSG00000034684
AA Change: K37N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 191 9.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194039
AA Change: K37N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142221
Gene: ENSMUSG00000034684
AA Change: K37N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 185 2e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin loop and a C-terminal basic domain. This gene is expressed by the endothelial cells where it was found to act in an autocrine fashion to induce apoptosis, inhibit cell proliferation and survival, and function as an anti-tumorigenic agent. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Inactivation of this locus results in neuronal defects including impaired CNS axon pathfinding, and PNS and limbic system circuitry. Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Sema3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Sema3f APN 9 107685522 missense probably benign 0.44
IGL01940:Sema3f APN 9 107683697 unclassified probably benign
IGL02070:Sema3f APN 9 107692241 missense probably damaging 1.00
IGL02381:Sema3f APN 9 107692395 missense probably damaging 1.00
IGL02472:Sema3f APN 9 107687736 missense probably damaging 1.00
IGL02557:Sema3f APN 9 107687212 missense probably damaging 1.00
IGL02614:Sema3f APN 9 107682511 missense probably benign 0.28
IGL02660:Sema3f APN 9 107683984 missense probably benign 0.05
R1468:Sema3f UTSW 9 107687572 unclassified probably benign
R1905:Sema3f UTSW 9 107684376 missense probably damaging 1.00
R4728:Sema3f UTSW 9 107705440 missense probably benign 0.00
R4772:Sema3f UTSW 9 107689720 nonsense probably null
R4786:Sema3f UTSW 9 107682682 missense probably benign 0.45
R4845:Sema3f UTSW 9 107685501 missense probably damaging 1.00
R5418:Sema3f UTSW 9 107692621 missense probably damaging 1.00
R5780:Sema3f UTSW 9 107682589 missense probably damaging 0.98
R5849:Sema3f UTSW 9 107682616 missense probably damaging 0.98
R5929:Sema3f UTSW 9 107692193 missense probably damaging 1.00
R6968:Sema3f UTSW 9 107691449 critical splice acceptor site probably null
R7043:Sema3f UTSW 9 107691400 missense possibly damaging 0.91
R7449:Sema3f UTSW 9 107684036 missense probably damaging 1.00
R7526:Sema3f UTSW 9 107689728 missense probably damaging 0.96
R7559:Sema3f UTSW 9 107684578 missense possibly damaging 0.52
R7640:Sema3f UTSW 9 107683575 missense probably benign 0.20
R7771:Sema3f UTSW 9 107692426 missense possibly damaging 0.89
R8058:Sema3f UTSW 9 107682601 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TCTACCCTAGAAGCTGCCTG -3'
(R):5'- TTCCCAGGTGTCCACAGAAC -3'

Sequencing Primer
(F):5'- TGGGACACAGACAGCCTTGAC -3'
(R):5'- ACAGAACTGGAGCCTGCTTC -3'
Posted On2019-11-26