Incidental Mutation 'R8301:Pex5'
ID639255
Institutional Source Beutler Lab
Gene Symbol Pex5
Ensembl Gene ENSMUSG00000005069
Gene Nameperoxisomal biogenesis factor 5
SynonymsESTM1, peroxisome biogenesis factor 5, PTS1R, Pxr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8301 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124396816-124415067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124405183 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000049132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035861] [ENSMUST00000080557] [ENSMUST00000112530] [ENSMUST00000112531] [ENSMUST00000112532]
Predicted Effect probably benign
Transcript: ENSMUST00000035861
AA Change: S180P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000049132
Gene: ENSMUSG00000005069
AA Change: S180P

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080557
AA Change: S180P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079398
Gene: ENSMUSG00000005069
AA Change: S180P

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112530
AA Change: S180P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108149
Gene: ENSMUSG00000005069
AA Change: S180P

DomainStartEndE-ValueType
low complexity region 224 240 N/A INTRINSIC
TPR 364 397 2.66e0 SMART
low complexity region 436 447 N/A INTRINSIC
TPR 481 514 1.76e-5 SMART
TPR 515 548 1.49e-3 SMART
TPR 549 582 3.87e-2 SMART
low complexity region 615 626 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112531
AA Change: S180P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108150
Gene: ENSMUSG00000005069
AA Change: S180P

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112532
AA Change: S180P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108151
Gene: ENSMUSG00000005069
AA Change: S180P

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced size, muscle weakness, respiratory distress, and retarded development and defects of the kidney, liver, brain, and intestine associated with lack of peroxisomes, and die within 3-4 days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Pex5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Pex5 APN 6 124398380 missense probably damaging 1.00
IGL02027:Pex5 APN 6 124398888 missense probably benign 0.20
IGL02041:Pex5 APN 6 124405281 splice site probably benign
IGL02128:Pex5 APN 6 124398460 missense probably damaging 1.00
IGL02507:Pex5 APN 6 124413305 missense probably benign
IGL02539:Pex5 APN 6 124403224 missense probably benign 0.02
IGL03180:Pex5 APN 6 124413563 splice site probably benign
R0143:Pex5 UTSW 6 124398489 missense probably damaging 1.00
R0600:Pex5 UTSW 6 124404637 missense probably benign 0.10
R0904:Pex5 UTSW 6 124399937 splice site probably benign
R1970:Pex5 UTSW 6 124414405 missense probably damaging 1.00
R4628:Pex5 UTSW 6 124403120 missense possibly damaging 0.90
R4879:Pex5 UTSW 6 124398363 missense probably benign 0.02
R5068:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5069:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5339:Pex5 UTSW 6 124398004 missense probably benign 0.02
R6433:Pex5 UTSW 6 124413613 missense possibly damaging 0.81
R6825:Pex5 UTSW 6 124414381 missense probably damaging 0.98
R6851:Pex5 UTSW 6 124403154 missense possibly damaging 0.92
R7148:Pex5 UTSW 6 124405272 missense probably benign 0.10
R7286:Pex5 UTSW 6 124398063 nonsense probably null
R7673:Pex5 UTSW 6 124399383 missense probably damaging 0.98
R7752:Pex5 UTSW 6 124403901 missense probably damaging 0.99
R7752:Pex5 UTSW 6 124414018 missense probably benign 0.03
R7793:Pex5 UTSW 6 124399341 missense probably benign 0.00
Z1177:Pex5 UTSW 6 124398386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAATAGGGCTCCCTCTGG -3'
(R):5'- GTAGGGCTCCTGTTCTCAGC -3'

Sequencing Primer
(F):5'- TGGGTAAGATTACTACTCATAGGTG -3'
(R):5'- CCTTTGGGAATAGCTCACAGAAG -3'
Posted On2020-07-28