Mutagenetix > Incidental Mutation

Incidental Mutation 'R8301:Polq'

639290

Institutional Source

Beutler Lab

Gene Symbol

Polq

Ensembl Gene

ENSMUSG00000034206

Gene Name

polymerase (DNA directed), theta

Synonyms

A430110D14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.308) question?

Stock #

R8301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37011786-37095417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 37061819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1448 (D1448E)

Ref Sequence

ENSEMBL: ENSMUSP00000059757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]

AlphaFold

Q8CGS6

Predicted Effect

probably damaging
Transcript: ENSMUST00000054034
AA Change: D1448E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: D1448E

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
DEXDc	87	298	4.09e-18	SMART
HELICc	398	484	4.02e-17	SMART
Blast:DEXDc	485	550	2e-25	BLAST
low complexity region	609	626	N/A	INTRINSIC
PDB:2ZJA\|A	712	826	5e-9	PDB
low complexity region	845	852	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
low complexity region	1126	1149	N/A	INTRINSIC
low complexity region	1813	1822	N/A	INTRINSIC
POLAc	2265	2504	3.3e-101	SMART
low complexity region	2521	2531	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071452
AA Change: D1169E

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: D1169E

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	216	5.9e-12	PFAM
low complexity region	330	347	N/A	INTRINSIC
PDB:2ZJA\|A	433	547	5e-9	PDB
low complexity region	566	573	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	847	870	N/A	INTRINSIC
low complexity region	1534	1543	N/A	INTRINSIC
POLAc	1986	2225	3.3e-101	SMART
low complexity region	2242	2252	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182946

SMART Domains

Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183112

SMART Domains

Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,972,505	I374F	probably benign	Het
Ak9	G	A	10: 41,424,716	V1108I		Het
Aldh16a1	C	T	7: 45,141,982	A790T	possibly damaging	Het
Anks1	A	T	17: 28,059,580		probably benign	Het
Antxr2	T	G	5: 97,977,679	T240P	probably benign	Het
Arfgef1	A	T	1: 10,179,833	M945K	probably damaging	Het
Arhgef17	T	C	7: 100,879,659	T1591A	probably benign	Het
Aurka	A	G	2: 172,356,930	S374P	probably damaging	Het
Bccip	T	C	7: 133,719,204	S236P	probably benign	Het
Cacna1s	T	A	1: 136,073,441		probably benign	Het
Calm1	A	G	12: 100,205,685	E132G	probably benign	Het
Casz1	A	G	4: 148,946,043	D1173G	probably damaging	Het
Cdh17	A	G	4: 11,795,659	D413G	probably damaging	Het
Cfap57	A	G	4: 118,593,074	I617T	possibly damaging	Het
Creb5	A	G	6: 53,681,033	D116G	possibly damaging	Het
Csnka2ip	A	C	16: 64,478,991	S337A	unknown	Het
Ddx60	A	G	8: 62,000,597	E1250G	probably benign	Het
Dlgap2	T	A	8: 14,823,577	S727T	probably benign	Het
Dpy19l1	T	C	9: 24,485,111		probably benign	Het
Ebf2	A	G	14: 67,238,982	T134A	possibly damaging	Het
Echdc2	A	T	4: 108,172,909	M136L	probably benign	Het
Enpp2	A	G	15: 54,851,407	F598S	probably benign	Het
Extl3	A	C	14: 65,076,284	L483R	probably damaging	Het
Gcat	T	C	15: 79,035,889	V227A	possibly damaging	Het
Hsf2	A	G	10: 57,505,346	D344G	probably damaging	Het
Ighm	C	T	12: 113,421,545	G265D		Het
Igsf9b	T	G	9: 27,334,739		probably benign	Het
Ints6	A	G	14: 62,702,453	V596A	probably benign	Het
Ints8	T	C	4: 11,246,120	E182G	probably damaging	Het
Iqgap2	A	G	13: 95,682,151		probably null	Het
Kalrn	G	T	16: 34,357,100	Q250K	probably benign	Het
Lrrc1	T	A	9: 77,544,488	N46Y	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naa50	A	G	16: 44,157,131	N74S	probably benign	Het
Neb	T	C	2: 52,288,835	N1303S	probably benign	Het
Nfs1	A	T	2: 156,134,493	C160*	probably null	Het
Olfr472	A	G	7: 107,903,626	K303R	probably benign	Het
Olfr591	T	G	7: 103,173,073	K188T	probably damaging	Het
Olfr740	T	A	14: 50,453,564	S171T	probably benign	Het
Olfr809	T	C	10: 129,776,840	S309P	probably benign	Het
Orm2	T	C	4: 63,363,026	F67S	possibly damaging	Het
Pex5	A	G	6: 124,405,183	S180P	probably benign	Het
Phf14	G	C	6: 11,992,062	G746R	probably damaging	Het
Pkm	T	A	9: 59,668,631	V110E	probably damaging	Het
Plekha6	T	G	1: 133,264,687	N78K	probably damaging	Het
Plxna2	G	A	1: 194,790,175	V1076I	probably benign	Het
Pot1b	T	C	17: 55,687,895	T256A	probably benign	Het
Prkch	C	T	12: 73,702,764	T377I	possibly damaging	Het
Prl3c1	A	C	13: 27,199,185		probably benign	Het
Prl7b1	A	C	13: 27,602,772	V158G	possibly damaging	Het
Prss22	T	C	17: 23,993,981	S261G	probably damaging	Het
Psd	T	C	19: 46,321,102		probably benign	Het
Psg18	A	T	7: 18,353,377	Y119N	probably damaging	Het
Rbm6	T	G	9: 107,852,794	R218S	probably damaging	Het
Rnf213	T	A	11: 119,434,742	S1491T		Het
Rsf1	T	C	7: 97,661,925	S621P		Het
Runx1	C	A	16: 92,605,656	*466L	probably null	Het
Samd4	A	G	14: 47,016,678	I200V	probably benign	Het
Sdsl	C	T	5: 120,459,519	C241Y	probably benign	Het
Selenon	T	C	4: 134,551,414		probably benign	Het
Setx	C	T	2: 29,145,690	P729L	possibly damaging	Het
Sf1	C	T	19: 6,368,366	Q55*	probably null	Het
Slc12a5	A	T	2: 164,993,691	N833I	probably damaging	Het
Slc1a4	T	C	11: 20,332,286	R63G	probably damaging	Het
Tmeff2	G	T	1: 51,181,837	A324S	probably benign	Het
Tmem217	A	G	17: 29,526,492	I88T	possibly damaging	Het
Tnfsf8	A	T	4: 63,860,878	I61N	probably benign	Het
Tpbgl	G	T	7: 99,625,567	A361E	probably damaging	Het
Trhde	T	A	10: 114,487,006	E667V	probably benign	Het
Unc13b	A	G	4: 43,263,568	T1598A	probably benign	Het
Vmn2r73	A	T	7: 85,858,302	C601S	probably benign	Het
Zfp873	C	A	10: 82,060,879	H481Q	probably damaging	Het

Other mutations in Polq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Polq	APN	16	37065247	splice site	probably benign
IGL00539:Polq	APN	16	37060569	missense	probably damaging	0.98
IGL00960:Polq	APN	16	37060512	missense	probably damaging	0.96
IGL01100:Polq	APN	16	37061112	missense	probably benign
IGL01112:Polq	APN	16	37017309	missense	probably damaging	1.00
IGL01138:Polq	APN	16	37045869	missense	possibly damaging	0.94
IGL01432:Polq	APN	16	37071822	splice site	probably benign
IGL01522:Polq	APN	16	37027903	missense	probably damaging	1.00
IGL01565:Polq	APN	16	37013113	missense	probably benign	0.00
IGL01592:Polq	APN	16	37034850	missense	probably benign	0.01
IGL01690:Polq	APN	16	37062838	missense	probably damaging	0.97
IGL01943:Polq	APN	16	37061443	missense	possibly damaging	0.47
IGL02531:Polq	APN	16	37062374	missense	possibly damaging	0.75
IGL02553:Polq	APN	16	37041768	missense	probably damaging	1.00
IGL02623:Polq	APN	16	37060375	missense	probably benign	0.04
IGL02692:Polq	APN	16	37060627	missense	probably damaging	1.00
IGL02717:Polq	APN	16	37022740	missense	probably damaging	1.00
IGL02937:Polq	APN	16	37013109	missense	probably benign	0.14
IGL02959:Polq	APN	16	37086566	missense	probably damaging	1.00
IGL03086:Polq	APN	16	37091049	missense	probably benign	0.02
IGL03141:Polq	APN	16	37017358	splice site	probably benign
IGL03302:Polq	APN	16	37071772	missense	probably damaging	1.00
IGL03393:Polq	APN	16	37044794	missense	probably damaging	1.00
R0013_Polq_667	UTSW	16	37061839	missense	possibly damaging	0.56
R4238_Polq_233	UTSW	16	37013181	missense	probably damaging	1.00
R4280_polq_867	UTSW	16	37082057	missense	probably damaging	1.00
G1Funyon:Polq	UTSW	16	37061819	missense	probably damaging	1.00
PIT4403001:Polq	UTSW	16	37060587	missense	probably benign	0.00
R0013:Polq	UTSW	16	37061839	missense	possibly damaging	0.56
R0082:Polq	UTSW	16	37017257	missense	probably benign	0.01
R0212:Polq	UTSW	16	37066854	missense	probably damaging	0.99
R0387:Polq	UTSW	16	37029430	missense	probably damaging	1.00
R0387:Polq	UTSW	16	37089317	missense	probably damaging	1.00
R0427:Polq	UTSW	16	37061993	nonsense	probably null
R0454:Polq	UTSW	16	37034890	missense	probably damaging	0.98
R0513:Polq	UTSW	16	37094502	missense	probably damaging	1.00
R0622:Polq	UTSW	16	37060993	missense	probably benign	0.02
R0848:Polq	UTSW	16	37062130	missense	probably benign	0.08
R1142:Polq	UTSW	16	37013217	missense	probably damaging	0.98
R1218:Polq	UTSW	16	37029446	missense	possibly damaging	0.93
R1331:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R1398:Polq	UTSW	16	37062495	missense	possibly damaging	0.87
R1424:Polq	UTSW	16	37086528	missense	probably damaging	1.00
R1644:Polq	UTSW	16	37060264	missense	probably damaging	0.96
R1777:Polq	UTSW	16	37060224	missense	possibly damaging	0.94
R1820:Polq	UTSW	16	37029418	missense	possibly damaging	0.48
R1854:Polq	UTSW	16	37062109	missense	probably benign	0.01
R1880:Polq	UTSW	16	37086592	missense	possibly damaging	0.90
R1932:Polq	UTSW	16	37062304	missense	possibly damaging	0.92
R2008:Polq	UTSW	16	37062482	missense	probably damaging	0.96
R2014:Polq	UTSW	16	37078366	missense	probably damaging	1.00
R2026:Polq	UTSW	16	37062745	missense	possibly damaging	0.93
R2178:Polq	UTSW	16	37062829	missense	probably damaging	1.00
R2259:Polq	UTSW	16	37062097	missense	probably benign	0.03
R2266:Polq	UTSW	16	37062153	missense	possibly damaging	0.59
R2305:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R2370:Polq	UTSW	16	37073939	missense	probably damaging	1.00
R2504:Polq	UTSW	16	37011942	missense	unknown
R2517:Polq	UTSW	16	37089325	missense	probably damaging	1.00
R2697:Polq	UTSW	16	37042153	missense	probably damaging	1.00
R2858:Polq	UTSW	16	37062753	missense	possibly damaging	0.88
R3436:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3437:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3699:Polq	UTSW	16	37042156	missense	probably damaging	1.00
R3838:Polq	UTSW	16	37078349	missense	probably damaging	1.00
R3875:Polq	UTSW	16	37074027	missense	probably damaging	0.99
R4050:Polq	UTSW	16	37092820	critical splice acceptor site	probably null
R4172:Polq	UTSW	16	37060758	missense	probably benign	0.02
R4238:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4240:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4280:Polq	UTSW	16	37082057	missense	probably damaging	1.00
R4296:Polq	UTSW	16	37061301	missense	possibly damaging	0.94
R4360:Polq	UTSW	16	37060339	missense	probably benign	0.00
R4373:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4375:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4376:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4509:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4510:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4511:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4543:Polq	UTSW	16	37060785	missense	probably benign	0.43
R4633:Polq	UTSW	16	37048542	missense	probably damaging	1.00
R4739:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R4834:Polq	UTSW	16	37027814	missense	probably damaging	1.00
R4841:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4842:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4937:Polq	UTSW	16	37027912	missense	probably benign	0.01
R4955:Polq	UTSW	16	37061082	missense	probably benign	0.32
R4992:Polq	UTSW	16	37061162	missense	possibly damaging	0.59
R5008:Polq	UTSW	16	37062387	missense	probably benign
R5221:Polq	UTSW	16	37042178	missense	probably damaging	0.98
R5254:Polq	UTSW	16	37089319	missense	probably damaging	1.00
R5292:Polq	UTSW	16	37061383	missense	probably damaging	1.00
R5375:Polq	UTSW	16	37082784	missense	probably damaging	1.00
R5480:Polq	UTSW	16	37013290	splice site	probably benign
R5552:Polq	UTSW	16	37094510	missense	possibly damaging	0.93
R5591:Polq	UTSW	16	37011885	utr 5 prime	probably benign
R5653:Polq	UTSW	16	37040534	missense	probably damaging	1.00
R5708:Polq	UTSW	16	37061018	missense	probably damaging	0.98
R5754:Polq	UTSW	16	37017263	missense	probably benign
R5757:Polq	UTSW	16	37086681	missense	probably benign	0.01
R5764:Polq	UTSW	16	37017344	missense	probably damaging	0.97
R6019:Polq	UTSW	16	37061764	missense	probably damaging	1.00
R6170:Polq	UTSW	16	37045812	missense	possibly damaging	0.82
R6177:Polq	UTSW	16	37071709	missense	probably damaging	0.98
R6307:Polq	UTSW	16	37017356	critical splice donor site	probably null
R6499:Polq	UTSW	16	37060827	missense	probably benign	0.03
R6520:Polq	UTSW	16	37060377	missense	possibly damaging	0.88
R6598:Polq	UTSW	16	37061631	missense	probably benign	0.39
R6694:Polq	UTSW	16	37015173	missense	probably null	0.99
R6788:Polq	UTSW	16	37077148	missense	probably damaging	1.00
R7104:Polq	UTSW	16	37089353	nonsense	probably null
R7159:Polq	UTSW	16	37062853	missense	possibly damaging	0.87
R7222:Polq	UTSW	16	37086633	nonsense	probably null
R7340:Polq	UTSW	16	37060926	missense	probably benign	0.00
R7361:Polq	UTSW	16	37060428	missense	probably benign	0.00
R7384:Polq	UTSW	16	37029418	missense	probably damaging	1.00
R7509:Polq	UTSW	16	37060343	missense	probably benign
R7509:Polq	UTSW	16	37060344	missense	probably benign	0.00
R7575:Polq	UTSW	16	37091134	missense	probably benign	0.00
R7785:Polq	UTSW	16	37027877	missense	probably damaging	1.00
R7787:Polq	UTSW	16	37017309	missense	probably damaging	1.00
R7891:Polq	UTSW	16	37027882	missense	probably damaging	1.00
R7898:Polq	UTSW	16	37044883	missense	probably damaging	0.98
R7917:Polq	UTSW	16	37065288	missense	probably benign	0.08
R7940:Polq	UTSW	16	37060642	missense	probably benign	0.27
R8028:Polq	UTSW	16	37061316	missense	possibly damaging	0.82
R8114:Polq	UTSW	16	37042215	missense	possibly damaging	0.94
R8144:Polq	UTSW	16	37029484	missense	probably benign	0.01
R8288:Polq	UTSW	16	37027910	missense	probably damaging	1.00
R8341:Polq	UTSW	16	37071771	missense	possibly damaging	0.96
R8348:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8448:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8815:Polq	UTSW	16	37033531	missense	probably damaging	1.00
R8843:Polq	UTSW	16	37011918	missense	unknown
R8878:Polq	UTSW	16	37040507	missense	probably benign	0.02
R9016:Polq	UTSW	16	37022797	missense	probably damaging	1.00
R9189:Polq	UTSW	16	37044903	missense	probably damaging	1.00
R9209:Polq	UTSW	16	37048649	missense	possibly damaging	0.94
R9352:Polq	UTSW	16	37041890	missense	probably damaging	0.98
R9398:Polq	UTSW	16	37061032	missense	probably benign	0.02
R9403:Polq	UTSW	16	37061853	missense	probably benign	0.00
R9489:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9605:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9664:Polq	UTSW	16	37027814	missense	probably damaging	0.98
R9801:Polq	UTSW	16	37092828	missense	probably damaging	1.00
X0060:Polq	UTSW	16	37017237	nonsense	probably null
Z1176:Polq	UTSW	16	37042257	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTCATCTTCCATACTCAAGGGG -3'
(R):5'- CACTGAGACAAACTCCTTGCTG -3'

Sequencing Primer
(F):5'- TCTTCCATACTCAAGGGGAAAATGG -3'
(R):5'- GAGACAAACTCCTTGCTGCTGAG -3'

Posted On

2020-07-28