Incidental Mutation 'R0070:Phf20l1'
List |< first << previous [record 37 of 69] next >> last >|
ID64469
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene NamePHD finger protein 20-like 1
SynonymsCGI-72, E130113K22Rik
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R0070 (G1)
Quality Score148
Status Not validated
Chromosome15
Chromosomal Location66577560-66647976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66639991 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 940 (W940G)
Ref Sequence ENSEMBL: ENSMUSP00000035682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]
Predicted Effect probably damaging
Transcript: ENSMUST00000048188
AA Change: W940G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: W940G

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229033
Predicted Effect probably damaging
Transcript: ENSMUST00000229160
AA Change: W939G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000229576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230250
Predicted Effect probably damaging
Transcript: ENSMUST00000230948
AA Change: W913G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231177
Meta Mutation Damage Score 0.2182 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66629035 missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66615633 splice site probably benign
IGL00668:Phf20l1 APN 15 66632849 missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66636832 missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66641908 missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66613132 missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66597691 missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66628991 missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66640025 missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66615410 critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66641801 missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66615632 splice site probably benign
IGL02656:Phf20l1 APN 15 66629827 missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66604864 missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66594980 critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66595151 missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66594884 missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66641947 utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66597403 missense probably damaging 1.00
Abbreviated UTSW 15 66632903 critical splice donor site probably null
curt UTSW 15 66639948 missense possibly damaging 0.90
shorthand UTSW 15 66609547 missense probably damaging 1.00
PIT4305001:Phf20l1 UTSW 15 66613052 missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66609604 missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66595122 missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66615630 splice site probably benign
R1458:Phf20l1 UTSW 15 66604813 missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66615259 missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66632825 missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66594920 missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66641816 missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66604837 missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66615222 missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66597367 missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66604855 missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66636913 missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66615785 missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66636820 missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66636824 missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66632903 critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66629824 missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66609547 missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66630913 missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66604840 missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66604789 missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66597750 missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66636884 missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66604084 missense probably benign 0.02
R7863:Phf20l1 UTSW 15 66615235 missense possibly damaging 0.94
R7991:Phf20l1 UTSW 15 66630919 missense possibly damaging 0.64
R8015:Phf20l1 UTSW 15 66639948 missense possibly damaging 0.90
R8161:Phf20l1 UTSW 15 66604073 missense probably damaging 1.00
R8228:Phf20l1 UTSW 15 66639940 missense possibly damaging 0.81
X0065:Phf20l1 UTSW 15 66597678 missense probably damaging 0.99
X0065:Phf20l1 UTSW 15 66629806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGATTGGCTCTTGCCTACCTAAG -3'
(R):5'- GTTACCCTGTATTGAGCCTACAACACC -3'

Sequencing Primer
(F):5'- TCTTGCCTACCTAAGTAGGATAATAG -3'
(R):5'- CCTCAGCAGGCAGGTAGTATATC -3'
Posted On2013-08-06