Incidental Mutation 'R8686:Irf4'
ID 662064
Institutional Source Beutler Lab
Gene Symbol Irf4
Ensembl Gene ENSMUSG00000021356
Gene Name interferon regulatory factor 4
Synonyms IRF-4, Spip
MMRRC Submission
Accession Numbers

Genbank: NM_013674; MGI: 1096873

Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock # R8686 (G1)
Quality Score 147.008
Status Validated
Chromosome 13
Chromosomal Location 30749226-30766976 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30761450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 393 (D393V)
Ref Sequence ENSEMBL: ENSMUSP00000021784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021784] [ENSMUST00000110307]
AlphaFold Q64287
Predicted Effect possibly damaging
Transcript: ENSMUST00000021784
AA Change: D393V

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021784
Gene: ENSMUSG00000021356
AA Change: D393V

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 249 418 1.17e-84 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110307
AA Change: D392V

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105936
Gene: ENSMUSG00000021356
AA Change: D392V

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 248 417 1.17e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display immune system abnormalities involving development of both T and B cells and affecting susceptibility to both bacterial and viral infections as well as impaired thermogenic gene expression and energy expenditure. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Irf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Irf4 APN 13 30751784 missense probably damaging 1.00
IGL01154:Irf4 APN 13 30757421 missense possibly damaging 0.46
IGL01669:Irf4 APN 13 30757471 missense probably damaging 0.99
IGL02729:Irf4 APN 13 30753591 critical splice donor site probably null
IGL03197:Irf4 APN 13 30763520 splice site probably benign
honey UTSW 13 30751751 missense probably damaging 0.99
Honey2 UTSW 13 30761490 splice site probably benign
miel UTSW 13 30761462 missense probably benign 0.00
R1300:Irf4 UTSW 13 30757585 missense probably damaging 0.98
R1656:Irf4 UTSW 13 30757502 missense probably benign
R1914:Irf4 UTSW 13 30761462 missense probably benign 0.00
R1915:Irf4 UTSW 13 30761462 missense probably benign 0.00
R3889:Irf4 UTSW 13 30761490 splice site probably benign
R4648:Irf4 UTSW 13 30763597 missense probably benign 0.00
R5553:Irf4 UTSW 13 30751828 missense probably damaging 1.00
R5913:Irf4 UTSW 13 30757758 missense probably benign
R7809:Irf4 UTSW 13 30757432 missense probably benign 0.07
R7894:Irf4 UTSW 13 30753452 missense probably benign
R8051:Irf4 UTSW 13 30761473 missense probably damaging 0.98
R8393:Irf4 UTSW 13 30763627 missense probably damaging 0.99
R8856:Irf4 UTSW 13 30761431 missense probably damaging 1.00
R9166:Irf4 UTSW 13 30757501 missense probably benign
R9352:Irf4 UTSW 13 30752723 missense probably benign
Z1177:Irf4 UTSW 13 30750661 missense probably damaging 0.98
Z1177:Irf4 UTSW 13 30750663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTAAGGGCTGGACTTAG -3'
(R):5'- TGTTCACTGGAGCCTGCTTC -3'

Sequencing Primer
(F):5'- GGCTCTCCCAAAGCAGACTTC -3'
(R):5'- GGAGCCTGCTTCCTCCTG -3'
Posted On 2021-03-08