Incidental Mutation 'R8686:Gm10696'
ID 662024
Institutional Source Beutler Lab
Gene Symbol Gm10696
Ensembl Gene ENSMUSG00000074424
Gene Name predicted gene 10696
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 94174412-94178193 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94176120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 128 (D128G)
Ref Sequence ENSEMBL: ENSMUSP00000124942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161475] [ENSMUST00000167916]
AlphaFold Q3UTC4
Predicted Effect probably benign
Transcript: ENSMUST00000161475
AA Change: D128G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124942
Gene: ENSMUSG00000074424
AA Change: D128G

DomainStartEndE-ValueType
MATH 24 130 4.7e-10 SMART
BTB 188 287 1.53e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167916
AA Change: D128G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132199
Gene: ENSMUSG00000074424
AA Change: D128G

DomainStartEndE-ValueType
MATH 24 130 4.7e-10 SMART
BTB 188 287 1.53e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Gm10696
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Gm10696 APN 3 94176237 missense probably damaging 1.00
IGL02057:Gm10696 APN 3 94176355 missense probably damaging 1.00
R1983:Gm10696 UTSW 3 94176294 missense possibly damaging 0.89
R2102:Gm10696 UTSW 3 94175666 nonsense probably null
R2110:Gm10696 UTSW 3 94175527 missense probably damaging 0.99
R2172:Gm10696 UTSW 3 94176298 missense possibly damaging 0.68
R2358:Gm10696 UTSW 3 94175547 missense possibly damaging 0.81
R2358:Gm10696 UTSW 3 94175548 missense possibly damaging 0.61
R4534:Gm10696 UTSW 3 94176450 missense probably benign 0.39
R4939:Gm10696 UTSW 3 94176233 nonsense probably null
R4961:Gm10696 UTSW 3 94175534 nonsense probably null
R4993:Gm10696 UTSW 3 94176316 missense probably damaging 1.00
R7154:Gm10696 UTSW 3 94176219 missense probably benign 0.17
R7218:Gm10696 UTSW 3 94175549 missense possibly damaging 0.91
R7256:Gm10696 UTSW 3 94176360 missense probably benign 0.01
R7464:Gm10696 UTSW 3 94176104 missense probably benign 0.08
R7473:Gm10696 UTSW 3 94176202 nonsense probably null
R7596:Gm10696 UTSW 3 94176430 missense probably benign 0.12
R7974:Gm10696 UTSW 3 94175541 missense probably benign 0.18
R8419:Gm10696 UTSW 3 94175614 missense probably benign 0.06
R8497:Gm10696 UTSW 3 94175812 missense possibly damaging 0.93
R8519:Gm10696 UTSW 3 94176190 missense probably benign 0.05
R9223:Gm10696 UTSW 3 94175643 missense probably damaging 1.00
Z1177:Gm10696 UTSW 3 94176102 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCTTGTGAGCCCTGAATTC -3'
(R):5'- ACCTGTCAGTTTACCTGGGG -3'

Sequencing Primer
(F):5'- CAGTCTGTGCACAGGGAATTCTC -3'
(R):5'- CTGGGGTTACTCCACTGTCAAAAG -3'
Posted On 2021-03-08