Mutagenetix > Incidental Mutation

Incidental Mutation 'R8699:Sorbs1'

668973

Institutional Source

Beutler Lab

Gene Symbol

Sorbs1

Ensembl Gene

ENSMUSG00000025006

Gene Name

sorbin and SH3 domain containing 1

Synonyms

9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.705) question?

Stock #

R8699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40294753-40513779 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 40376800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 180 (R180G)

Ref Sequence

ENSEMBL: ENSMUSP00000153313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099466

SMART Domains

Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	203	249	1.07e-26	SMART
SH3	502	557	2.72e-18	SMART
SH3	576	633	9.32e-17	SMART
low complexity region	647	660	N/A	INTRINSIC
SH3	682	739	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099467
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: R180G

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
low complexity region	192	213	N/A	INTRINSIC
Sorb	327	373	1.24e-22	SMART
coiled coil region	558	584	N/A	INTRINSIC
SH3	700	755	2.72e-18	SMART
SH3	774	831	9.32e-17	SMART
low complexity region	845	858	N/A	INTRINSIC
SH3	880	937	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165212

SMART Domains

Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	193	239	1.07e-26	SMART
SH3	486	541	2.72e-18	SMART
SH3	560	617	9.32e-17	SMART
low complexity region	631	644	N/A	INTRINSIC
SH3	666	723	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165469

SMART Domains

Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	75	93	N/A	INTRINSIC
Sorb	233	279	1.07e-26	SMART
SH3	476	531	2.72e-18	SMART
SH3	550	607	9.32e-17	SMART
low complexity region	621	634	N/A	INTRINSIC
SH3	656	713	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224233

Predicted Effect

probably benign
Transcript: ENSMUST00000224247

Predicted Effect

probably benign
Transcript: ENSMUST00000224583

Predicted Effect

probably benign
Transcript: ENSMUST00000224667

Predicted Effect

probably benign
Transcript: ENSMUST00000225148

Predicted Effect

probably benign
Transcript: ENSMUST00000225153
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225786

Predicted Effect

probably benign
Transcript: ENSMUST00000226047

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,931,057	K82E	probably benign	Het
4933430I17Rik	T	C	4: 62,532,278	W30R	probably damaging	Het
Abca3	A	G	17: 24,408,225	D1555G	probably benign	Het
Anapc1	T	C	2: 128,641,453	T1241A	probably damaging	Het
Ano5	G	A	7: 51,593,771	V881I	probably benign	Het
Appl1	G	A	14: 26,940,255	S490L	probably benign	Het
Asxl3	A	G	18: 22,434,607	T81A	probably benign	Het
Bclaf1	T	C	10: 20,333,438	S754P	possibly damaging	Het
Bicra	G	T	7: 15,989,188	Q135K	probably benign	Het
Cad	T	C	5: 31,076,261	V1951A	possibly damaging	Het
Cadm3	T	A	1: 173,341,116	Y295F	probably damaging	Het
Ccnt1	A	G	15: 98,565,114	I59T	probably damaging	Het
Ccr6	C	T	17: 8,256,566	T201M	probably benign	Het
Cd5	A	G	19: 10,725,192	F209S	possibly damaging	Het
Cep126	A	C	9: 8,087,361	D1017E	probably damaging	Het
Cntnap4	A	T	8: 112,757,596	D427V	probably damaging	Het
Col4a4	T	A	1: 82,455,734	N1496I	unknown	Het
Crybg3	A	G	16: 59,554,928	Y274H	probably damaging	Het
Cubn	C	A	2: 13,383,959	S1479I	probably damaging	Het
Diras2	A	T	13: 52,508,107	C55S	probably damaging	Het
Dleu7	G	A	14: 62,292,830	R41C	probably benign	Het
Exo5	A	G	4: 120,921,996	I224T	probably damaging	Het
Fcho1	T	C	8: 71,709,633	I774V	possibly damaging	Het
Gclm	T	G	3: 122,266,323	S251A	possibly damaging	Het
Gm11639	A	G	11: 104,781,246	T1464A	probably benign	Het
Gm13889	T	C	2: 93,956,982	Q49R	unknown	Het
Gm35315	T	A	5: 110,080,526	H18L	probably benign	Het
Gm9949	G	A	18: 62,183,972	G65R	unknown	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gria4	C	A	9: 4,424,347	K839N	probably damaging	Het
Gria4	T	G	9: 4,424,351	Y838S	probably damaging	Het
Hrh3	A	G	2: 180,101,356	W160R	probably damaging	Het
Htr4	G	A	18: 62,437,692	A273T	probably damaging	Het
Lig3	G	T	11: 82,794,550	C599F	probably damaging	Het
Lrp1b	A	T	2: 41,282,195	V1594E		Het
Map3k10	A	T	7: 27,668,355	V286D	probably damaging	Het
Map4k4	T	A	1: 39,976,750	V117E	unknown	Het
Mdga1	C	T	17: 29,842,374	V548M	possibly damaging	Het
Mms22l	A	T	4: 24,507,363	L248F	possibly damaging	Het
Ncaph	T	C	2: 127,121,176	D379G	possibly damaging	Het
Neb	A	G	2: 52,147,234	V7064A	probably benign	Het
Neb	G	A	2: 52,212,551	T4570M	probably benign	Het
Npy5r	G	T	8: 66,681,622	T173K	probably damaging	Het
Olfr1002	A	T	2: 85,647,986	C112S	possibly damaging	Het
Olfr1037	A	T	2: 86,085,174	I201N	probably damaging	Het
Olfr1442	A	G	19: 12,674,882	M226V	probably benign	Het
Olfr1447	A	T	19: 12,901,464	F105L	possibly damaging	Het
Olfr622	A	T	7: 103,639,615	I175N	probably damaging	Het
Oxsm	A	G	14: 16,242,631	I46T	possibly damaging	Het
Pcdha1	A	T	18: 36,931,023	I247F	probably benign	Het
Pcdhgb6	A	T	18: 37,742,922	I228L	probably benign	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Ppp1r9a	A	G	6: 5,115,474	S866G	probably benign	Het
Ppp6r3	T	A	19: 3,496,587	S304C	probably damaging	Het
Pramef6	A	T	4: 143,897,192	N137K	probably benign	Het
Ptprd	A	T	4: 76,041,392	F279I	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rest	G	A	5: 77,281,542	G603R	probably benign	Het
Rgs17	A	T	10: 5,918,194	L9M	probably benign	Het
Rtp1	A	G	16: 23,431,383	Y166C	probably damaging	Het
Sec24b	C	A	3: 130,005,004	R572I	probably damaging	Het
Setd1a	G	T	7: 127,786,602	R827L	possibly damaging	Het
Sh3tc1	T	C	5: 35,701,891	Y1091C	probably damaging	Het
Stat4	T	A	1: 52,071,937	M181K	probably benign	Het
Stk16	A	G	1: 75,212,038	E67G	probably benign	Het
Supv3l1	A	G	10: 62,432,455	V537A	possibly damaging	Het
Tmc8	A	G	11: 117,783,535	E101G	possibly damaging	Het
Tmem106a	A	T	11: 101,582,294		probably benign	Het
Tpr	T	A	1: 150,418,021	I922N	probably damaging	Het
Uaca	G	T	9: 60,871,065	L911F	probably damaging	Het
Ubn1	A	T	16: 5,063,703	I200L	possibly damaging	Het
Ush2a	A	G	1: 188,911,377	D4312G	probably damaging	Het
Virma	A	T	4: 11,528,678	Y1255F	probably benign	Het
Vmn1r170	C	T	7: 23,606,655	Q161*	probably null	Het
Vmn1r175	G	T	7: 23,808,809	A131D	probably benign	Het
Vmn1r52	T	A	6: 90,178,760	N15K	probably benign	Het
Wdr46	T	A	17: 33,948,852	I513N	probably damaging	Het
Wdr60	T	C	12: 116,207,701	T972A	probably benign	Het
Zfp788	A	G	7: 41,648,416	N159D	probably benign	Het

Other mutations in Sorbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sorbs1	APN	19	40318029	missense	probably damaging	1.00
IGL00776:Sorbs1	APN	19	40344351	splice site	probably null
IGL00788:Sorbs1	APN	19	40337043	splice site	probably benign
IGL00943:Sorbs1	APN	19	40295040	utr 3 prime	probably benign
IGL01525:Sorbs1	APN	19	40349978	missense	probably damaging	1.00
IGL01530:Sorbs1	APN	19	40376647	missense	probably benign	0.01
IGL01951:Sorbs1	APN	19	40318016	splice site	probably benign
IGL02159:Sorbs1	APN	19	40327596	missense	probably damaging	0.96
IGL02252:Sorbs1	APN	19	40314397	missense	probably damaging	1.00
IGL02613:Sorbs1	APN	19	40327547	missense	probably damaging	1.00
IGL02643:Sorbs1	APN	19	40365133	missense	possibly damaging	0.65
IGL02668:Sorbs1	APN	19	40314681	missense	probably damaging	1.00
IGL02738:Sorbs1	APN	19	40376904	missense	probably damaging	0.97
IGL02965:Sorbs1	APN	19	40376743	missense	probably benign	0.01
IGL03083:Sorbs1	APN	19	40314376	missense	probably damaging	1.00
IGL03173:Sorbs1	APN	19	40363262	missense	probably damaging	1.00
IGL03286:Sorbs1	APN	19	40344414	missense	probably damaging	0.99
IGL03292:Sorbs1	APN	19	40373565	missense	possibly damaging	0.79
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0306:Sorbs1	UTSW	19	40344411	missense	possibly damaging	0.94
R0526:Sorbs1	UTSW	19	40349948	missense	probably damaging	1.00
R0551:Sorbs1	UTSW	19	40311816	missense	probably damaging	1.00
R0688:Sorbs1	UTSW	19	40363262	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1891:Sorbs1	UTSW	19	40393460	missense	probably damaging	0.99
R2066:Sorbs1	UTSW	19	40365028	splice site	probably null
R2148:Sorbs1	UTSW	19	40376824	missense	possibly damaging	0.94
R2214:Sorbs1	UTSW	19	40296631	missense	probably damaging	1.00
R2410:Sorbs1	UTSW	19	40373515	missense	probably damaging	0.99
R2940:Sorbs1	UTSW	19	40373571	missense	probably damaging	1.00
R3847:Sorbs1	UTSW	19	40314443	missense	probably damaging	0.97
R4405:Sorbs1	UTSW	19	40395745	missense	probably benign	0.03
R4544:Sorbs1	UTSW	19	40311850	missense	probably damaging	0.99
R4618:Sorbs1	UTSW	19	40373518	missense	probably damaging	0.99
R4731:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4732:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4733:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4907:Sorbs1	UTSW	19	40340047	nonsense	probably null
R4912:Sorbs1	UTSW	19	40311727	missense	probably damaging	1.00
R5229:Sorbs1	UTSW	19	40340707	missense	probably damaging	1.00
R5285:Sorbs1	UTSW	19	40321890	missense	probably damaging	1.00
R5416:Sorbs1	UTSW	19	40376989	missense	probably benign	0.06
R5706:Sorbs1	UTSW	19	40376881	missense	probably benign
R5871:Sorbs1	UTSW	19	40398583	missense	probably damaging	1.00
R5936:Sorbs1	UTSW	19	40324772	missense	probably damaging	0.96
R6073:Sorbs1	UTSW	19	40314657	missense	probably damaging	1.00
R6324:Sorbs1	UTSW	19	40321819	missense	probably damaging	0.99
R6343:Sorbs1	UTSW	19	40376982	critical splice donor site	probably null
R6561:Sorbs1	UTSW	19	40326052	missense	probably benign
R6646:Sorbs1	UTSW	19	40325549	missense	probably damaging	1.00
R6768:Sorbs1	UTSW	19	40327547	missense	probably damaging	1.00
R6849:Sorbs1	UTSW	19	40376800	missense	probably benign
R6850:Sorbs1	UTSW	19	40376800	missense	probably benign
R6878:Sorbs1	UTSW	19	40376800	missense	probably benign
R6879:Sorbs1	UTSW	19	40376800	missense	probably benign
R6880:Sorbs1	UTSW	19	40376800	missense	probably benign
R6908:Sorbs1	UTSW	19	40352332	missense	probably damaging	1.00
R6980:Sorbs1	UTSW	19	40327616	nonsense	probably null
R7040:Sorbs1	UTSW	19	40376800	missense	probably benign
R7041:Sorbs1	UTSW	19	40376800	missense	probably benign
R7110:Sorbs1	UTSW	19	40376800	missense	probably benign
R7122:Sorbs1	UTSW	19	40376800	missense	probably benign
R7170:Sorbs1	UTSW	19	40326129	nonsense	probably null
R7180:Sorbs1	UTSW	19	40376800	missense	probably benign
R7185:Sorbs1	UTSW	19	40376800	missense	probably benign
R7187:Sorbs1	UTSW	19	40376800	missense	probably benign
R7254:Sorbs1	UTSW	19	40376800	missense	probably benign
R7255:Sorbs1	UTSW	19	40376800	missense	probably benign
R7401:Sorbs1	UTSW	19	40376800	missense	probably benign
R7595:Sorbs1	UTSW	19	40314653	missense	probably damaging	0.99
R7819:Sorbs1	UTSW	19	40376800	missense	probably benign
R7876:Sorbs1	UTSW	19	40296588	missense	probably damaging	1.00
R7894:Sorbs1	UTSW	19	40327576	missense	probably benign	0.02
R7986:Sorbs1	UTSW	19	40365005	missense	probably damaging	0.99
R8031:Sorbs1	UTSW	19	40326489	missense	probably benign	0.17
R8082:Sorbs1	UTSW	19	40365083	missense	probably benign	0.08
R8282:Sorbs1	UTSW	19	40376800	missense	probably benign
R8283:Sorbs1	UTSW	19	40376800	missense	probably benign
R8446:Sorbs1	UTSW	19	40326158	missense	probably benign
R8526:Sorbs1	UTSW	19	40376800	missense	probably benign
R8527:Sorbs1	UTSW	19	40376800	missense	probably benign
R8528:Sorbs1	UTSW	19	40376800	missense	probably benign
R8539:Sorbs1	UTSW	19	40376800	missense	probably benign
R8540:Sorbs1	UTSW	19	40376800	missense	probably benign
R8542:Sorbs1	UTSW	19	40376800	missense	probably benign
R8543:Sorbs1	UTSW	19	40376800	missense	probably benign
R8544:Sorbs1	UTSW	19	40376800	missense	probably benign
R8545:Sorbs1	UTSW	19	40376800	missense	probably benign
R8684:Sorbs1	UTSW	19	40376800	missense	probably benign
R8702:Sorbs1	UTSW	19	40376800	missense	probably benign
R8752:Sorbs1	UTSW	19	40361428	critical splice donor site	probably null
R8937:Sorbs1	UTSW	19	40373562	missense	probably benign	0.02
R8956:Sorbs1	UTSW	19	40363216	missense	probably damaging	1.00
R8960:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9175:Sorbs1	UTSW	19	40326574	missense	probably damaging	1.00
R9208:Sorbs1	UTSW	19	40365018	start gained	probably benign
R9211:Sorbs1	UTSW	19	40344354	critical splice donor site	probably null
R9371:Sorbs1	UTSW	19	40326880	missense	probably damaging	0.98
R9374:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9377:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9551:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9552:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9686:Sorbs1	UTSW	19	40393510	missense	probably damaging	1.00
Z1177:Sorbs1	UTSW	19	40326895	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTCCAGCAAGCTTACGGTACTTG -3'
(R):5'- TTATTTCCCACAGGGTGCCAC -3'

Sequencing Primer
(F):5'- AGCTTACGGTACTTGAGACAGCTC -3'
(R):5'- CAGCCCCGTCTGAGGTAATAGTTG -3'

Posted On

2021-04-30