Incidental Mutation 'R8988:Reln'
ID 684205
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 068820-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R8988 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 21884454-22344702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21899157 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3272 (D3272G)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062372
AA Change: D3272G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: D3272G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: D3272G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: D3272G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,699,979 N330S probably benign Het
Abi2 C T 1: 60,450,092 T291I probably benign Het
Aox1 A C 1: 58,049,466 D137A possibly damaging Het
Apbb2 T C 5: 66,452,101 K68E probably damaging Het
Arf3 A T 15: 98,741,052 M108K probably benign Het
Atg2b T A 12: 105,617,129 I2058F probably damaging Het
Bhlhe40 C T 6: 108,662,557 L99F probably damaging Het
Cyp2b10 G A 7: 25,926,245 R500H probably damaging Het
Dlc1 C T 8: 36,572,843 E937K probably damaging Het
Dll3 A T 7: 28,296,368 V336D possibly damaging Het
Dync2h1 A G 9: 7,037,727 F3377L probably benign Het
Eef1d A G 15: 75,896,311 Y561H probably damaging Het
Epb41l1 C A 2: 156,521,671 T700K probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Ephb2 C A 4: 136,675,458 G501C probably benign Het
Erbb3 T C 10: 128,570,161 Y1129C probably damaging Het
Fbn1 C T 2: 125,370,806 V799M possibly damaging Het
Fbxo9 G A 9: 78,084,651 P353S probably benign Het
Ggt1 T G 10: 75,576,222 V100G probably benign Het
Gm11639 T G 11: 105,020,526 V4544G probably benign Het
Gm45861 T C 8: 27,542,503 M885T unknown Het
Gm609 T C 16: 45,417,908 H294R probably benign Het
Grin2d A T 7: 45,834,001 Y917* probably null Het
Hectd4 T A 5: 121,277,756 V540D possibly damaging Het
Helz T A 11: 107,604,253 I351K probably damaging Het
Ighv2-6-8 A G 12: 113,796,360 V43A probably damaging Het
Igkv9-129 T A 6: 67,840,122 I70N probably damaging Het
Il18 A T 9: 50,577,878 D69V probably damaging Het
Kcnh7 T A 2: 62,721,865 E927D Het
Kcnt2 T A 1: 140,428,849 V342E probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Krt18 C G 15: 102,029,527 A153G probably damaging Het
Lmntd2 A T 7: 141,212,064 probably benign Het
Lrrc26 G T 2: 25,290,274 A96S probably benign Het
Map3k11 A T 19: 5,702,138 S783C probably damaging Het
Mib2 G A 4: 155,656,272 L632F possibly damaging Het
Mical2 A C 7: 112,311,454 D277A possibly damaging Het
Mtr A T 13: 12,235,479 F339L probably benign Het
Musk T C 4: 58,354,032 F362L probably benign Het
Ncor1 G A 11: 62,343,045 Q444* probably null Het
Nek4 T C 14: 30,963,967 S279P Het
Nell1 C T 7: 50,560,795 T348I unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nrip1 T C 16: 76,292,014 H885R probably damaging Het
Olfr1382 C A 11: 49,535,201 N5K probably damaging Het
Olfr214 A G 6: 116,557,294 T290A possibly damaging Het
Olfr448 T A 6: 42,897,267 V272D Het
Olfr525 G A 7: 140,323,025 G109R possibly damaging Het
Olfr784 T C 10: 129,388,371 V246A probably damaging Het
Olfr822 T A 10: 130,074,653 V81D possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
P3h3 C A 6: 124,857,601 Q29H possibly damaging Het
Parn A G 16: 13,648,417 probably null Het
Pcnt C A 10: 76,409,573 E1077* probably null Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pigb A G 9: 73,022,294 W336R probably damaging Het
Pkdrej A T 15: 85,816,337 S1799R probably damaging Het
Pnpla6 G T 8: 3,517,401 M86I possibly damaging Het
Prickle2 T C 6: 92,458,639 K50E possibly damaging Het
Psg21 A G 7: 18,652,464 V199A probably benign Het
Reep3 T C 10: 67,036,007 probably null Het
Rps6ka4 A G 19: 6,831,299 V526A possibly damaging Het
Sel1l3 T C 5: 53,123,429 E911G probably damaging Het
Serpinb6b C A 13: 32,978,142 A308E probably benign Het
Slc26a4 A G 12: 31,522,524 V746A probably benign Het
Slc4a3 T G 1: 75,551,313 M402R probably damaging Het
Slc9b1 A T 3: 135,373,139 T186S possibly damaging Het
Slk A G 19: 47,620,273 Q555R probably benign Het
Smc2 T A 4: 52,475,100 D925E probably benign Het
Stat5a A T 11: 100,883,938 T758S unknown Het
Sulf1 A G 1: 12,836,275 S514G probably benign Het
Tcp11l1 T A 2: 104,706,508 N4I probably damaging Het
Tex2 A T 11: 106,511,905 I1047K unknown Het
Tmem184b A G 15: 79,377,064 V114A possibly damaging Het
Trmt11 A G 10: 30,591,031 V95A probably benign Het
Trp53bp2 A G 1: 182,440,868 D169G possibly damaging Het
Ttc41 T A 10: 86,713,735 N264K possibly damaging Het
Uba2 A C 7: 34,154,562 S318R probably benign Het
Wapl T A 14: 34,729,182 N724K probably damaging Het
Wfdc9 T A 2: 164,651,751 I5F probably damaging Het
Zan C T 5: 137,408,301 D3686N unknown Het
Zfp618 A T 4: 63,094,471 Y140F probably benign Het
Zfp790 A G 7: 29,828,168 T93A probably benign Het
Zfp979 A C 4: 147,613,527 F242V probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
Fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22286896 missense possibly damaging 0.71
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
R7085:Reln UTSW 5 21915087 nonsense probably null
R7091:Reln UTSW 5 21899029 missense probably null 0.08
R7135:Reln UTSW 5 21976596 missense possibly damaging 0.95
R7146:Reln UTSW 5 22106097 missense probably damaging 0.97
R7167:Reln UTSW 5 21942620 missense probably damaging 1.00
R7190:Reln UTSW 5 22047947 missense probably damaging 1.00
R7256:Reln UTSW 5 21978923 missense probably benign 0.03
R7393:Reln UTSW 5 21976351 missense probably damaging 0.99
R7399:Reln UTSW 5 22051367 missense probably damaging 0.99
R7400:Reln UTSW 5 21971934 missense probably damaging 0.99
R7426:Reln UTSW 5 21971953 missense probably damaging 1.00
R7463:Reln UTSW 5 22103435 missense probably damaging 0.98
R7470:Reln UTSW 5 21942741 missense probably damaging 0.99
R7473:Reln UTSW 5 21929127 missense probably benign 0.25
R7501:Reln UTSW 5 22227638 missense possibly damaging 0.91
R7542:Reln UTSW 5 21955181 missense probably damaging 1.00
R7544:Reln UTSW 5 21976278 nonsense probably null
R7588:Reln UTSW 5 21885568 missense probably benign 0.03
R7631:Reln UTSW 5 21971935 missense probably damaging 0.97
R7644:Reln UTSW 5 21978931 missense probably benign 0.39
R7834:Reln UTSW 5 22039635 missense possibly damaging 0.94
R7923:Reln UTSW 5 22134692 missense probably benign 0.00
R7938:Reln UTSW 5 21950872 missense probably damaging 0.97
R8006:Reln UTSW 5 21899084 nonsense probably null
R8062:Reln UTSW 5 21971992 missense probably benign 0.00
R8222:Reln UTSW 5 21931477 nonsense probably null
R8266:Reln UTSW 5 22018087 missense possibly damaging 0.62
R8267:Reln UTSW 5 22004112 missense probably damaging 1.00
R8487:Reln UTSW 5 21899029 missense probably benign 0.03
R8523:Reln UTSW 5 22004231 missense probably damaging 1.00
R8751:Reln UTSW 5 21942674 missense probably benign 0.37
R8801:Reln UTSW 5 21950856 missense possibly damaging 0.94
R8802:Reln UTSW 5 21925259 missense probably damaging 0.98
R8978:Reln UTSW 5 21885514 missense possibly damaging 0.85
R8995:Reln UTSW 5 21979579 missense probably benign 0.00
R9022:Reln UTSW 5 21976615 missense possibly damaging 0.66
R9042:Reln UTSW 5 22048038 missense probably damaging 1.00
R9069:Reln UTSW 5 22011061 missense probably damaging 1.00
R9089:Reln UTSW 5 21925200 missense probably benign 0.01
R9126:Reln UTSW 5 21955196 missense probably damaging 1.00
R9172:Reln UTSW 5 21950817 critical splice donor site probably null
R9182:Reln UTSW 5 21901619 missense probably benign 0.44
R9196:Reln UTSW 5 22152473 missense probably damaging 1.00
R9211:Reln UTSW 5 22344202 nonsense probably null
R9241:Reln UTSW 5 21969069 missense probably damaging 0.99
R9244:Reln UTSW 5 21915153 missense probably damaging 0.99
R9281:Reln UTSW 5 21948547 missense probably damaging 1.00
R9295:Reln UTSW 5 22004211 missense possibly damaging 0.95
R9303:Reln UTSW 5 21988707 missense possibly damaging 0.95
R9303:Reln UTSW 5 22080691 missense probably benign 0.01
R9309:Reln UTSW 5 21971868 missense probably benign 0.37
R9338:Reln UTSW 5 21997939 missense probably damaging 0.98
R9381:Reln UTSW 5 22344204 missense possibly damaging 0.93
R9430:Reln UTSW 5 21915107 missense probably damaging 1.00
R9509:Reln UTSW 5 22344200 missense possibly damaging 0.93
R9515:Reln UTSW 5 21920510 missense possibly damaging 0.46
R9717:Reln UTSW 5 21931429 missense probably benign 0.26
R9745:Reln UTSW 5 21947527 missense probably damaging 1.00
R9778:Reln UTSW 5 21950945 missense probably damaging 1.00
Z1176:Reln UTSW 5 21979024 missense probably damaging 1.00
Z1177:Reln UTSW 5 21969241 missense probably damaging 0.96
Z1177:Reln UTSW 5 22004082 missense probably damaging 0.96
Z1177:Reln UTSW 5 22154959 missense probably benign 0.05
Z1177:Reln UTSW 5 22227636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTGTGTCTTGAATATGGCAC -3'
(R):5'- AAATGATTGCTTCTGGGAGCG -3'

Sequencing Primer
(F):5'- ACAGGGCTTGCTCACCTTG -3'
(R):5'- GAGCCTGCCTGGTACTTCACTG -3'
Posted On 2021-10-11