Incidental Mutation 'R6101:Map6'
ID 485255
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 044251-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R6101 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98917314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000146585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: V29A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: V29A

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000122101
AA Change: V29A

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: V29A

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: V29A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180761
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: V29A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209094
Predicted Effect probably benign
Transcript: ENSMUST00000208924
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 25,460,775 (GRCm39) C570S probably damaging Het
Adh6b T A 3: 138,063,471 (GRCm39) I350K possibly damaging Het
Ahnak G A 19: 8,981,463 (GRCm39) V916I probably benign Het
Aldh4a1 C T 4: 139,365,806 (GRCm39) P266S possibly damaging Het
Arhgap11a G A 2: 113,665,219 (GRCm39) R460* probably null Het
Chl1 A T 6: 103,669,993 (GRCm39) D477V probably damaging Het
Clstn3 A T 6: 124,438,629 (GRCm39) L45Q probably damaging Het
Cnot7 C T 8: 40,963,078 (GRCm39) R32Q probably benign Het
Csrnp1 T C 9: 119,802,551 (GRCm39) D220G probably damaging Het
Cyb5a G A 18: 84,889,718 (GRCm39) R49Q possibly damaging Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Glul T A 1: 153,782,177 (GRCm39) Y137* probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Igha T A 12: 113,220,017 (GRCm39) probably benign Het
Kif2b A G 11: 91,466,814 (GRCm39) S490P probably benign Het
Kxd1 A T 8: 70,972,589 (GRCm39) N33K probably benign Het
Lrrk2 T C 15: 91,607,338 (GRCm39) I567T probably benign Het
Man2a2 T C 7: 80,016,749 (GRCm39) D355G probably damaging Het
Mical3 A T 6: 121,010,671 (GRCm39) V437D probably damaging Het
Mief1 T C 15: 80,133,941 (GRCm39) Y333H probably benign Het
Or12j4 T A 7: 140,046,432 (GRCm39) V106D probably benign Het
Or4f7 A G 2: 111,644,598 (GRCm39) F158L probably benign Het
Or8b52 A G 9: 38,576,916 (GRCm39) S75P probably damaging Het
Or8d2b T C 9: 38,788,604 (GRCm39) L44P possibly damaging Het
Pak1ip1 T A 13: 41,158,361 (GRCm39) L78Q probably damaging Het
Pikfyve A G 1: 65,303,504 (GRCm39) probably null Het
Pinlyp C T 7: 24,245,405 (GRCm39) R5K possibly damaging Het
Pkd1l3 A G 8: 110,367,478 (GRCm39) D1225G probably damaging Het
Pnma8b T A 7: 16,680,493 (GRCm39) S492R probably benign Het
Postn A G 3: 54,279,641 (GRCm39) probably null Het
Ptprq A G 10: 107,416,127 (GRCm39) Y1724H possibly damaging Het
Rpn2 T A 2: 157,152,108 (GRCm39) probably null Het
Scn5a A G 9: 119,351,716 (GRCm39) V755A probably damaging Het
Slc22a30 T C 19: 8,315,232 (GRCm39) probably null Het
Specc1l T C 10: 75,084,466 (GRCm39) S730P probably damaging Het
Steap2 T A 5: 5,725,891 (GRCm39) I378F possibly damaging Het
Tdrd12 A T 7: 35,180,558 (GRCm39) Y818* probably null Het
Thbs4 G T 13: 92,911,993 (GRCm39) Q246K possibly damaging Het
Tnfsf10 A G 3: 27,389,698 (GRCm39) Y253C probably damaging Het
Tnpo3 G T 6: 29,588,042 (GRCm39) C125* probably null Het
Trim58 A G 11: 58,542,441 (GRCm39) N467S probably benign Het
Trpm6 C T 19: 18,831,112 (GRCm39) R1326* probably null Het
Zc3hav1l A G 6: 38,270,012 (GRCm39) V279A probably benign Het
Zfp618 A T 4: 63,051,478 (GRCm39) Q753L probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zkscan17 A T 11: 59,394,401 (GRCm39) C67S probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCAGCGGTACCTTGTCC -3'
(R):5'- AAGTCCTTCTGGTACTGGGTCTC -3'

Sequencing Primer
(F):5'- TCCCCGGGTGCTCTTTGAG -3'
(R):5'- TAGTCCTGTCGCATCACCGAG -3'
Posted On 2017-08-16