Incidental Mutation 'R9182:Myh13'
ID 697130
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, extraocular myosin, MyHC-eo
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R9182 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67321658-67371586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67337753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 373 (E373G)
Ref Sequence ENSEMBL: ENSMUSP00000080584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect probably damaging
Transcript: ENSMUST00000081911
AA Change: E373G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: E373G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108684
AA Change: E373G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: E373G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180845
AA Change: E373G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: E373G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,095,607 M190K probably damaging Het
4833423E24Rik T C 2: 85,500,237 H242R probably benign Het
4931406B18Rik A G 7: 43,504,216 W3R probably damaging Het
Acap3 T C 4: 155,905,435 L720P probably damaging Het
Actc1 T C 2: 114,052,013 T7A probably benign Het
Angpt2 T A 8: 18,710,642 probably null Het
Babam2 T A 5: 31,901,057 D228E possibly damaging Het
BC067074 A G 13: 113,320,824 N1135D Het
Ccar1 G A 10: 62,785,568 L34F probably damaging Het
Ccdc83 T C 7: 90,236,894 D219G probably damaging Het
Cct2 A G 10: 117,056,120 V341A probably benign Het
Cdc20b G A 13: 113,071,969 probably null Het
Chd7 T A 4: 8,838,737 L1312Q probably damaging Het
Cltc G A 11: 86,705,156 T1252I probably damaging Het
Cnpy1 G T 5: 28,245,801 D2E possibly damaging Het
Crat C T 2: 30,408,073 V205M probably damaging Het
Dgkb T C 12: 38,166,777 probably null Het
Dglucy T C 12: 100,844,769 V254A possibly damaging Het
Disp3 A G 4: 148,270,384 S392P probably damaging Het
Dlx6 A T 6: 6,863,456 Q26L probably benign Het
Dnah3 T C 7: 120,085,128 D258G probably damaging Het
Dnah6 A T 6: 73,144,705 Y1431* probably null Het
Dnah7b T C 1: 46,290,878 I3294T probably benign Het
Dnaic2 A G 11: 114,733,013 N34S probably benign Het
Dock2 T C 11: 34,310,398 K981R possibly damaging Het
Entpd8 T C 2: 25,081,919 I33T probably benign Het
Eppk1 A G 15: 76,111,253 L476P probably benign Het
Etv1 T A 12: 38,780,717 probably null Het
Fam193a T A 5: 34,466,017 N1316K possibly damaging Het
Fkbp4 T C 6: 128,438,419 E31G probably benign Het
Fnbp1l C T 3: 122,569,696 D81N probably damaging Het
Fstl4 T C 11: 53,134,078 V259A probably damaging Het
Glipr1l1 T C 10: 112,076,151 S197P probably damaging Het
Gm4450 C T 3: 98,446,689 A165T possibly damaging Het
Gprin3 A T 6: 59,354,212 M370K probably benign Het
Gsc G T 12: 104,472,861 Y85* probably null Het
Gys2 T G 6: 142,446,009 Y509S probably damaging Het
Gys2 T C 6: 142,461,252 N126S possibly damaging Het
Hmcn1 A T 1: 150,612,654 W4292R probably damaging Het
Hmcn1 C A 1: 150,624,586 E3952* probably null Het
Htr1f T C 16: 64,926,462 M156V probably benign Het
Il21r G A 7: 125,629,041 G228E probably benign Het
Kat6b C T 14: 21,517,119 S82L probably benign Het
Kntc1 T A 5: 123,802,292 L1651Q probably damaging Het
Lipi G T 16: 75,560,785 Y297* probably null Het
Mapre3 T C 5: 30,864,672 S190P possibly damaging Het
Mmp8 T A 9: 7,567,466 Y442* probably null Het
Mt3 G A 8: 94,153,987 E62K unknown Het
Mut A G 17: 40,941,419 E284G probably damaging Het
Myh7 T C 14: 54,988,917 Y422C probably damaging Het
Nalcn A G 14: 123,596,604 V53A probably damaging Het
Nucb2 A G 7: 116,521,835 probably null Het
Olfr449 A T 6: 42,838,076 N65I probably benign Het
Olfr537-ps1 A T 7: 140,538,869 L117F probably benign Het
Olfr555 A T 7: 102,659,720 I300L probably damaging Het
Olfr620 T C 7: 103,611,856 K166E possibly damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Olfr923 C A 9: 38,827,876 H56N probably damaging Het
Opn5 A T 17: 42,592,999 H148Q probably damaging Het
Osmr T A 15: 6,821,088 D679V probably damaging Het
Pde4dip T C 3: 97,694,998 D2305G probably benign Het
Pdgfrl A T 8: 40,976,959 Q121L probably damaging Het
Pls1 C A 9: 95,776,758 V226F probably damaging Het
Plxnd1 T A 6: 115,993,785 I341F probably damaging Het
Ppfia2 T A 10: 106,927,779 M1211K probably benign Het
Ppfibp2 T A 7: 107,708,846 Y229N possibly damaging Het
Prss53 A G 7: 127,888,382 S266P probably benign Het
Pycr2 C T 1: 180,906,832 Q226* probably null Het
Rad50 T C 11: 53,692,763 H397R probably benign Het
Raf1 T C 6: 115,623,479 E393G probably damaging Het
Reln T C 5: 21,901,619 D3251G probably benign Het
Robo4 A T 9: 37,401,910 probably benign Het
Sbf1 A T 15: 89,289,603 probably null Het
Serpinb6a T C 13: 33,925,377 D145G probably damaging Het
Setx T A 2: 29,171,287 M2236K probably damaging Het
Sgms1 A G 19: 32,124,358 V416A probably benign Het
Six5 T G 7: 19,097,007 S520A probably benign Het
Sox5 T A 6: 143,833,392 I722F possibly damaging Het
Spag17 T G 3: 100,058,842 I1147S possibly damaging Het
Spice1 C T 16: 44,385,702 T842I possibly damaging Het
Ssbp2 A G 13: 91,700,681 T358A probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tbc1d2b C A 9: 90,270,599 C38F probably damaging Het
Tecrl C A 5: 83,309,202 probably null Het
Tgm7 T C 2: 121,096,499 N390D probably benign Het
Thsd4 T G 9: 59,987,366 M770L probably benign Het
Tmod2 C A 9: 75,597,342 probably benign Het
Tnks A G 8: 34,841,751 probably null Het
Tox3 T C 8: 90,257,879 N224S probably benign Het
Trappc10 C T 10: 78,214,630 E326K probably damaging Het
Usp16 T A 16: 87,479,654 F627I probably benign Het
Vcam1 T C 3: 116,117,355 I465V probably benign Het
Vmn1r128 T C 7: 21,349,758 I129T possibly damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r2 A T 3: 64,137,381 C115S probably damaging Het
Vmn2r85 A C 10: 130,429,481 S44R probably benign Het
Wasf3 T A 5: 146,466,825 Y248* probably null Het
Yipf5 A T 18: 40,210,798 L127M probably damaging Het
Zbp1 G T 2: 173,209,140 C312* probably null Het
Zfp423 A T 8: 87,782,114 F534Y probably damaging Het
Zfp69 T G 4: 120,935,111 Y156S probably damaging Het
Zmat4 A G 8: 23,929,210 N155S probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67364606 missense probably benign 0.00
R9088:Myh13 UTSW 11 67352059 missense probably damaging 1.00
R9151:Myh13 UTSW 11 67361323 missense probably damaging 1.00
R9154:Myh13 UTSW 11 67362492 missense probably benign
R9332:Myh13 UTSW 11 67363283 missense possibly damaging 0.57
R9393:Myh13 UTSW 11 67352068 missense probably benign
R9446:Myh13 UTSW 11 67364499 missense probably benign 0.01
R9474:Myh13 UTSW 11 67364886 missense
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCACTCGTGTGAGCAAATG -3'
(R):5'- AGGCATGTCTTGAGAGTAGATGATG -3'

Sequencing Primer
(F):5'- CAAATGCTGTCTCGTCTGATACACAG -3'
(R):5'- TGAGAGTAGATGATGATTTGACACC -3'
Posted On 2022-02-07