Incidental Mutation 'R8434:Myh13'
ID653909
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R8434 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 67363185 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably null
Transcript: ENSMUST00000081911
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181027
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,260 T737A probably damaging Het
2310034C09Rik A G 16: 88,759,372 Y158C probably damaging Het
Abhd18 T A 3: 40,930,896 S239T possibly damaging Het
Ankrd13b G A 11: 77,477,726 T56I probably benign Het
Arhgef10l T A 4: 140,564,271 Q454L possibly damaging Het
Atp1a2 T C 1: 172,284,612 E572G probably benign Het
Cdk5rap2 T C 4: 70,364,020 H164R probably benign Het
Clca4b A G 3: 144,926,156 M196T probably benign Het
Cnbd1 T G 4: 19,055,045 K127T probably benign Het
Cog3 A T 14: 75,742,396 V165E probably damaging Het
Crim1 G A 17: 78,347,257 R654H probably benign Het
Ctnnb1 G A 9: 120,957,562 V617I possibly damaging Het
Dach1 T A 14: 98,168,693 Q206L probably damaging Het
Dhx30 C T 9: 110,100,906 V41I probably benign Het
Dnase2a T C 8: 84,909,781 L176P probably damaging Het
Dpp10 T C 1: 123,433,010 D262G probably damaging Het
Dsel T A 1: 111,861,655 E383D probably damaging Het
Flt1 T A 5: 147,639,443 Y585F probably damaging Het
Fubp1 T A 3: 152,220,553 I304N probably damaging Het
Gab2 A G 7: 97,299,130 D309G probably damaging Het
Gon4l T C 3: 88,854,779 V291A probably damaging Het
Gpam C T 19: 55,081,631 V398M possibly damaging Het
Grin3b C T 10: 79,974,588 R643C probably damaging Het
Hdac3 T A 18: 37,941,422 H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 Q326L unknown Het
Ivl T A 3: 92,572,636 T41S probably benign Het
Lama4 C T 10: 39,026,707 P226S possibly damaging Het
Lpin1 A G 12: 16,563,620 probably null Het
Lrrc42 A T 4: 107,247,524 N81K probably damaging Het
Mast4 A T 13: 102,761,392 H838Q probably damaging Het
Mcmdc2 A G 1: 9,920,581 M314V possibly damaging Het
Me3 A G 7: 89,739,878 E130G probably damaging Het
Mpnd A G 17: 56,009,405 D28G possibly damaging Het
Mtch2 G T 2: 90,852,864 E102* probably null Het
Olfr1117-ps1 G A 2: 87,284,634 V115I probably benign Het
Olfr291 C A 7: 84,857,289 H309N probably benign Het
Plch2 T A 4: 154,989,735 D891V probably damaging Het
Ppfibp2 T C 7: 107,728,750 probably null Het
Rag1 A G 2: 101,642,664 L711P probably damaging Het
Sacs T A 14: 61,213,187 Y4227* probably null Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sema3a T C 5: 13,473,520 probably null Het
Sp1 C T 15: 102,409,683 L546F probably benign Het
Syne1 T C 10: 5,123,057 N1256S probably benign Het
Tcrg-V3 A G 13: 19,242,866 T8A probably benign Het
Tns1 T C 1: 73,925,606 S33G probably benign Het
Tpsab1 A G 17: 25,345,471 L3P possibly damaging Het
Vmn1r44 T C 6: 89,893,628 S119P possibly damaging Het
Vmn2r31 A G 7: 7,384,700 L624P probably damaging Het
Vps33a A T 5: 123,533,881 W475R possibly damaging Het
Xpnpep3 G T 15: 81,427,594 R167L possibly damaging Het
Zfhx4 T A 3: 5,398,858 S1384T probably damaging Het
Zfp3 G A 11: 70,772,558 E448K probably benign Het
Zfp362 T A 4: 128,785,976 H299L probably damaging Het
Zfp664 C T 5: 124,885,763 L74F possibly damaging Het
Zfp808 A G 13: 62,172,112 Y385C probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTCTACATAGTTCAGGTGAGGC -3'
(R):5'- AGTGAGGACTCTAAGCCTCTGG -3'

Sequencing Primer
(F):5'- TTCAGGTGAGGCAACACTTC -3'
(R):5'- CCTCTGGCTGGAAAACCTC -3'
Posted On2020-10-20