Incidental Mutation 'R1483:Akap6'
ID 165723
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 039536-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.868) question?
Stock # R1483 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 52699383-53155599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 52796087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 73 (P73S)
Ref Sequence ENSEMBL: ENSMUSP00000151871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: P73S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: P73S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: P73S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,930,025 (GRCm38) T494S probably benign Het
Amotl2 A T 9: 102,730,897 (GRCm38) T763S probably benign Het
Brd10 G A 19: 29,719,345 (GRCm38) P916L possibly damaging Het
Cdc5l A T 17: 45,408,364 (GRCm38) V541D possibly damaging Het
Chl1 A G 6: 103,647,287 (GRCm38) Y52C probably damaging Het
D6Wsu163e A G 6: 126,954,770 (GRCm38) E255G probably benign Het
Ddhd2 A G 8: 25,753,128 (GRCm38) S126P probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 (GRCm38) probably benign Het
Drc3 A G 11: 60,388,889 (GRCm38) I427V probably benign Het
Drg2 T C 11: 60,459,527 (GRCm38) I104T probably damaging Het
Dst C T 1: 34,252,998 (GRCm38) A932V probably damaging Het
Ecm1 G A 3: 95,735,963 (GRCm38) R342C probably damaging Het
Eif3a A T 19: 60,768,726 (GRCm38) D880E unknown Het
Elf1 T A 14: 79,580,638 (GRCm38) D569E probably benign Het
Esp6 T A 17: 40,562,925 (GRCm38) M1K probably null Het
Fer1l6 T C 15: 58,637,970 (GRCm38) V1427A possibly damaging Het
Gsta1 A T 9: 78,242,493 (GRCm38) K196M probably damaging Het
Gzme T A 14: 56,118,712 (GRCm38) I110F probably damaging Het
H2-DMa T A 17: 34,135,750 (GRCm38) V27E possibly damaging Het
H2-T10 A T 17: 36,121,146 (GRCm38) S2T probably benign Het
Hadhb A G 5: 30,169,494 (GRCm38) probably null Het
Hoxa11 G T 6: 52,243,456 (GRCm38) D282E probably damaging Het
Ifit1bl1 A G 19: 34,594,641 (GRCm38) Y139H possibly damaging Het
Ift27 A G 15: 78,165,236 (GRCm38) V88A possibly damaging Het
Knop1 C T 7: 118,853,050 (GRCm38) A149T probably damaging Het
Macf1 T A 4: 123,510,977 (GRCm38) K597I probably damaging Het
Med16 A T 10: 79,903,100 (GRCm38) I284N possibly damaging Het
Melk T A 4: 44,308,937 (GRCm38) I98K probably damaging Het
Mst1 G T 9: 108,081,650 (GRCm38) G127V probably benign Het
Nacad A G 11: 6,602,217 (GRCm38) S325P probably damaging Het
Nbea G A 3: 56,002,790 (GRCm38) P1328L probably benign Het
Nek5 C T 8: 22,096,790 (GRCm38) S335N probably benign Het
Nif3l1 C A 1: 58,447,726 (GRCm38) R24S probably benign Het
Nlrp14 T G 7: 107,190,122 (GRCm38) N39K possibly damaging Het
Nup50 T A 15: 84,939,727 (GRCm38) V427D probably damaging Het
Nwd1 C T 8: 72,657,086 (GRCm38) P78L probably damaging Het
Or5an9 T A 19: 12,209,750 (GRCm38) Y61* probably null Het
Pate8 G A 9: 36,581,324 (GRCm38) S95L probably benign Het
Pnkd A G 1: 74,349,391 (GRCm38) Y242C probably benign Het
Ppm1g T C 5: 31,203,121 (GRCm38) D423G probably benign Het
Pramel32 T A 4: 88,628,834 (GRCm38) Q116L probably damaging Het
Prkci A T 3: 31,043,792 (GRCm38) N464Y probably damaging Het
Ptprf C T 4: 118,235,964 (GRCm38) V494M possibly damaging Het
Rapgef4 T G 2: 72,055,026 (GRCm38) probably null Het
Rbak T C 5: 143,174,344 (GRCm38) E318G probably damaging Het
Rora A G 9: 69,364,385 (GRCm38) D215G probably benign Het
Rp1l1 C T 14: 64,029,047 (GRCm38) T694I possibly damaging Het
Scrib A G 15: 76,057,922 (GRCm38) L1032P probably damaging Het
Sectm1b G A 11: 121,055,826 (GRCm38) T81M probably benign Het
Sgk3 T C 1: 9,872,293 (GRCm38) F97L possibly damaging Het
Socs3 A T 11: 117,967,568 (GRCm38) Y221* probably null Het
Spata31d1e A T 13: 59,742,903 (GRCm38) S368T probably damaging Het
Tdrd6 T A 17: 43,627,607 (GRCm38) H850L probably benign Het
Tex44 G T 1: 86,427,186 (GRCm38) Q272H probably damaging Het
Tgfbr2 A C 9: 116,109,557 (GRCm38) S426A probably benign Het
Tmem39b T C 4: 129,676,663 (GRCm38) Y461C probably damaging Het
Ttn T A 2: 76,724,993 (GRCm38) D30556V probably damaging Het
Tubgcp5 T A 7: 55,825,707 (GRCm38) probably null Het
Vmn2r70 T C 7: 85,559,167 (GRCm38) I701V probably benign Het
Vps39 A T 2: 120,323,648 (GRCm38) L622Q probably damaging Het
Wdfy4 T A 14: 33,100,966 (GRCm38) H1347L probably benign Het
Xpo1 A G 11: 23,284,863 (GRCm38) I540V probably benign Het
Xylt2 A C 11: 94,669,567 (GRCm38) M294R probably benign Het
Zfp788 T G 7: 41,649,075 (GRCm38) Y326* probably null Het
Zim1 A G 7: 6,682,125 (GRCm38) F109L probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53,140,980 (GRCm38) missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52,887,102 (GRCm38) missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52,937,217 (GRCm38) missense probably damaging 0.96
IGL01458:Akap6 APN 12 52,886,818 (GRCm38) nonsense probably null
IGL01589:Akap6 APN 12 53,139,664 (GRCm38) missense probably damaging 1.00
IGL01592:Akap6 APN 12 53,142,142 (GRCm38) missense probably damaging 1.00
IGL01738:Akap6 APN 12 52,886,817 (GRCm38) missense probably damaging 0.99
IGL01867:Akap6 APN 12 52,888,008 (GRCm38) missense probably damaging 1.00
IGL02025:Akap6 APN 12 53,140,335 (GRCm38) missense probably benign
IGL02041:Akap6 APN 12 53,140,653 (GRCm38) missense probably damaging 1.00
IGL02058:Akap6 APN 12 53,140,555 (GRCm38) missense probably damaging 1.00
IGL02194:Akap6 APN 12 52,886,823 (GRCm38) missense probably benign 0.00
IGL02226:Akap6 APN 12 53,010,467 (GRCm38) splice site probably benign
IGL02323:Akap6 APN 12 53,140,429 (GRCm38) missense probably benign 0.00
IGL02449:Akap6 APN 12 53,140,188 (GRCm38) missense probably damaging 1.00
IGL02475:Akap6 APN 12 53,139,494 (GRCm38) missense probably benign 0.03
IGL02546:Akap6 APN 12 52,880,738 (GRCm38) missense probably damaging 1.00
IGL02547:Akap6 APN 12 53,140,696 (GRCm38) missense probably damaging 1.00
IGL02588:Akap6 APN 12 52,886,499 (GRCm38) nonsense probably null
IGL02608:Akap6 APN 12 53,010,606 (GRCm38) missense probably benign 0.39
IGL02884:Akap6 APN 12 52,886,622 (GRCm38) missense probably benign 0.00
IGL02945:Akap6 APN 12 52,880,837 (GRCm38) missense probably damaging 1.00
IGL03029:Akap6 APN 12 52,886,412 (GRCm38) missense probably damaging 1.00
IGL03129:Akap6 APN 12 53,140,306 (GRCm38) missense probably damaging 1.00
R0133:Akap6 UTSW 12 53,139,471 (GRCm38) nonsense probably null
R0166:Akap6 UTSW 12 53,140,924 (GRCm38) missense probably benign 0.04
R0189:Akap6 UTSW 12 53,141,254 (GRCm38) missense probably benign 0.41
R0532:Akap6 UTSW 12 52,887,983 (GRCm38) missense probably benign 0.00
R0632:Akap6 UTSW 12 52,937,148 (GRCm38) missense probably damaging 1.00
R0666:Akap6 UTSW 12 52,911,808 (GRCm38) missense probably damaging 1.00
R0723:Akap6 UTSW 12 53,141,902 (GRCm38) missense probably damaging 1.00
R0763:Akap6 UTSW 12 53,142,214 (GRCm38) missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52,886,622 (GRCm38) missense probably benign 0.00
R0879:Akap6 UTSW 12 52,880,799 (GRCm38) missense probably damaging 1.00
R0880:Akap6 UTSW 12 53,139,508 (GRCm38) missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53,069,222 (GRCm38) missense probably damaging 0.97
R1055:Akap6 UTSW 12 52,880,672 (GRCm38) nonsense probably null
R1199:Akap6 UTSW 12 52,796,190 (GRCm38) missense probably damaging 1.00
R1295:Akap6 UTSW 12 52,887,029 (GRCm38) missense probably damaging 1.00
R1389:Akap6 UTSW 12 53,139,520 (GRCm38) missense probably benign 0.15
R1471:Akap6 UTSW 12 53,141,496 (GRCm38) missense probably benign 0.05
R1512:Akap6 UTSW 12 52,937,154 (GRCm38) missense probably damaging 1.00
R1648:Akap6 UTSW 12 53,142,006 (GRCm38) nonsense probably null
R1791:Akap6 UTSW 12 53,069,125 (GRCm38) missense probably damaging 1.00
R1888:Akap6 UTSW 12 53,142,175 (GRCm38) missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53,142,175 (GRCm38) missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53,142,175 (GRCm38) missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53,141,852 (GRCm38) missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53,104,612 (GRCm38) missense probably benign 0.13
R1970:Akap6 UTSW 12 52,938,475 (GRCm38) missense probably damaging 0.96
R1987:Akap6 UTSW 12 53,140,795 (GRCm38) missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53,140,795 (GRCm38) missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53,141,404 (GRCm38) missense probably benign 0.03
R2567:Akap6 UTSW 12 52,938,373 (GRCm38) missense probably damaging 1.00
R2568:Akap6 UTSW 12 52,887,278 (GRCm38) missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53,140,143 (GRCm38) missense probably benign
R3051:Akap6 UTSW 12 52,887,033 (GRCm38) missense probably damaging 1.00
R3195:Akap6 UTSW 12 53,072,457 (GRCm38) nonsense probably null
R3196:Akap6 UTSW 12 53,072,457 (GRCm38) nonsense probably null
R3426:Akap6 UTSW 12 52,888,034 (GRCm38) missense probably damaging 1.00
R3783:Akap6 UTSW 12 52,880,769 (GRCm38) missense probably damaging 1.00
R3934:Akap6 UTSW 12 53,140,444 (GRCm38) missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53,140,444 (GRCm38) missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53,141,453 (GRCm38) missense probably damaging 1.00
R3970:Akap6 UTSW 12 53,141,453 (GRCm38) missense probably damaging 1.00
R4042:Akap6 UTSW 12 53,139,379 (GRCm38) critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53,139,462 (GRCm38) missense probably damaging 1.00
R4152:Akap6 UTSW 12 53,140,407 (GRCm38) missense probably benign 0.45
R4231:Akap6 UTSW 12 53,141,038 (GRCm38) missense probably damaging 1.00
R4232:Akap6 UTSW 12 53,139,671 (GRCm38) missense probably damaging 1.00
R4233:Akap6 UTSW 12 53,139,671 (GRCm38) missense probably damaging 1.00
R4234:Akap6 UTSW 12 53,139,671 (GRCm38) missense probably damaging 1.00
R4235:Akap6 UTSW 12 53,139,671 (GRCm38) missense probably damaging 1.00
R4236:Akap6 UTSW 12 53,139,671 (GRCm38) missense probably damaging 1.00
R4475:Akap6 UTSW 12 53,141,643 (GRCm38) missense probably benign 0.00
R4513:Akap6 UTSW 12 52,796,004 (GRCm38) missense probably benign 0.03
R4686:Akap6 UTSW 12 52,887,623 (GRCm38) frame shift probably null
R4724:Akap6 UTSW 12 52,795,885 (GRCm38) missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52,887,623 (GRCm38) frame shift probably null
R4852:Akap6 UTSW 12 53,104,675 (GRCm38) missense probably damaging 1.00
R5024:Akap6 UTSW 12 53,142,562 (GRCm38) missense probably benign 0.01
R5116:Akap6 UTSW 12 53,141,515 (GRCm38) missense probably benign 0.01
R5164:Akap6 UTSW 12 53,142,466 (GRCm38) missense probably benign
R5225:Akap6 UTSW 12 52,886,546 (GRCm38) missense probably damaging 1.00
R5269:Akap6 UTSW 12 53,139,843 (GRCm38) missense probably damaging 0.99
R5352:Akap6 UTSW 12 52,796,097 (GRCm38) missense probably damaging 1.00
R5496:Akap6 UTSW 12 53,140,653 (GRCm38) missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52,795,964 (GRCm38) missense probably damaging 1.00
R5997:Akap6 UTSW 12 52,937,233 (GRCm38) critical splice donor site probably null
R6137:Akap6 UTSW 12 53,140,354 (GRCm38) missense probably damaging 1.00
R6151:Akap6 UTSW 12 53,025,792 (GRCm38) missense probably damaging 1.00
R6169:Akap6 UTSW 12 53,142,358 (GRCm38) missense probably benign
R6307:Akap6 UTSW 12 53,141,568 (GRCm38) missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53,142,025 (GRCm38) missense probably damaging 0.98
R6479:Akap6 UTSW 12 53,141,169 (GRCm38) missense probably damaging 1.00
R6502:Akap6 UTSW 12 53,140,215 (GRCm38) missense probably damaging 1.00
R6760:Akap6 UTSW 12 53,139,778 (GRCm38) missense probably damaging 1.00
R6778:Akap6 UTSW 12 53,025,816 (GRCm38) missense probably damaging 1.00
R6837:Akap6 UTSW 12 53,141,262 (GRCm38) missense probably damaging 1.00
R6896:Akap6 UTSW 12 52,887,494 (GRCm38) missense probably benign 0.06
R6917:Akap6 UTSW 12 53,069,168 (GRCm38) missense probably null 0.97
R6983:Akap6 UTSW 12 52,887,653 (GRCm38) missense probably damaging 1.00
R7142:Akap6 UTSW 12 52,887,364 (GRCm38) missense probably benign 0.02
R7143:Akap6 UTSW 12 52,887,364 (GRCm38) missense probably benign 0.02
R7216:Akap6 UTSW 12 53,140,457 (GRCm38) missense probably benign 0.02
R7297:Akap6 UTSW 12 52,887,364 (GRCm38) missense probably benign 0.02
R7356:Akap6 UTSW 12 52,911,864 (GRCm38) missense probably damaging 1.00
R7378:Akap6 UTSW 12 53,142,574 (GRCm38) missense probably benign 0.00
R7382:Akap6 UTSW 12 53,142,171 (GRCm38) missense probably benign 0.00
R7498:Akap6 UTSW 12 53,142,705 (GRCm38) nonsense probably null
R7542:Akap6 UTSW 12 53,069,234 (GRCm38) missense probably damaging 1.00
R7589:Akap6 UTSW 12 53,142,063 (GRCm38) nonsense probably null
R7676:Akap6 UTSW 12 52,886,850 (GRCm38) missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53,140,961 (GRCm38) missense probably benign 0.28
R7971:Akap6 UTSW 12 53,139,795 (GRCm38) missense probably damaging 1.00
R8039:Akap6 UTSW 12 53,141,676 (GRCm38) missense probably benign 0.00
R8425:Akap6 UTSW 12 52,886,621 (GRCm38) missense probably benign 0.00
R8747:Akap6 UTSW 12 53,142,216 (GRCm38) missense probably benign 0.01
R8885:Akap6 UTSW 12 53,141,536 (GRCm38) missense probably benign
R8956:Akap6 UTSW 12 53,140,344 (GRCm38) missense probably benign 0.00
R8989:Akap6 UTSW 12 52,880,871 (GRCm38) missense probably damaging 1.00
R9014:Akap6 UTSW 12 53,139,620 (GRCm38) missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53,142,048 (GRCm38) missense probably benign 0.36
R9216:Akap6 UTSW 12 52,880,885 (GRCm38) missense probably benign 0.05
R9220:Akap6 UTSW 12 53,140,449 (GRCm38) missense possibly damaging 0.49
R9243:Akap6 UTSW 12 53,141,252 (GRCm38) missense probably benign 0.08
R9286:Akap6 UTSW 12 53,072,471 (GRCm38) missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53,069,111 (GRCm38) missense probably damaging 1.00
R9475:Akap6 UTSW 12 53,010,552 (GRCm38) missense probably damaging 1.00
R9509:Akap6 UTSW 12 53,142,238 (GRCm38) missense probably damaging 0.99
R9523:Akap6 UTSW 12 52,795,889 (GRCm38) missense probably benign 0.02
R9600:Akap6 UTSW 12 52,886,558 (GRCm38) missense probably benign 0.04
R9612:Akap6 UTSW 12 52,911,907 (GRCm38) missense probably damaging 1.00
R9627:Akap6 UTSW 12 53,104,630 (GRCm38) missense
R9666:Akap6 UTSW 12 53,141,535 (GRCm38) missense probably benign
R9784:Akap6 UTSW 12 53,141,070 (GRCm38) missense probably damaging 1.00
X0062:Akap6 UTSW 12 53,142,361 (GRCm38) missense probably benign 0.43
Z1176:Akap6 UTSW 12 53,140,444 (GRCm38) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGAGTGTGACCCTTTCCCCACTG -3'
(R):5'- ATTGCTTCAAAGGCAGGCAGCCTC -3'

Sequencing Primer
(F):5'- GTCCCAGGACCCAGACC -3'
(R):5'- AACGATCTGGCTACCGTTATGAG -3'
Posted On 2014-03-28