Incidental Mutation 'R9452:Scn2a'
ID 714309
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Scn2a1, Nav1.2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9452 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65620771-65767447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65764819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 2004 (S2004N)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably benign
Transcript: ENSMUST00000028377
AA Change: S2004N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: S2004N

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100067
AA Change: S2004N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: S2004N

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200829
AA Change: S2004N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: S2004N

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 A G 5: 24,407,384 Y564C probably null Het
Ablim2 A T 5: 35,857,854 D470V probably benign Het
Actr10 T C 12: 70,960,044 probably null Het
Adam4 T A 12: 81,420,297 I517L probably benign Het
Ank1 C A 8: 23,132,413 D1659E probably benign Het
Arnt2 A G 7: 84,284,126 V308A probably benign Het
Avl9 T C 6: 56,729,741 V184A probably damaging Het
Bag1 A T 4: 40,947,733 I157N probably benign Het
BC005561 T A 5: 104,521,744 N1377K probably benign Het
Bicc1 A T 10: 70,957,151 D224E probably damaging Het
C2 T G 17: 34,876,343 I209L probably benign Het
Cacna1e A T 1: 154,413,974 probably null Het
Capn1 T C 19: 6,007,257 Y387C probably damaging Het
Cebpa A G 7: 35,119,608 I64V possibly damaging Het
Celf4 T G 18: 25,491,162 M436L probably benign Het
Cfb C A 17: 34,859,108 V436L probably benign Het
Ciart C T 3: 95,881,215 C104Y probably benign Het
Cmya5 A G 13: 93,095,886 L898P probably benign Het
Cyp2c68 A T 19: 39,699,389 M388K possibly damaging Het
Cypt12 T C 3: 17,948,679 V72A probably benign Het
Dlec1 A G 9: 119,112,473 D309G probably benign Het
Dnah1 A G 14: 31,296,491 V1394A probably benign Het
Dpp3 A C 19: 4,923,722 S108A probably benign Het
Eif5b C T 1: 38,045,780 P903S probably damaging Het
Erc2 A G 14: 28,011,733 D580G probably damaging Het
Fam98c A G 7: 29,153,476 V44A probably benign Het
Fer A G 17: 63,924,072 K273E probably benign Het
Gm906 T C 13: 50,246,772 H506R possibly damaging Het
Gm9268 A T 7: 43,047,833 L771F possibly damaging Het
Gzme T A 14: 56,118,397 I153F probably benign Het
Ice1 A T 13: 70,596,343 N2040K probably damaging Het
Ifi214 G T 1: 173,529,328 Q70K possibly damaging Het
Itpripl1 C A 2: 127,141,414 E263* probably null Het
Kat8 A G 7: 127,925,249 K433R probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lefty1 A T 1: 180,935,284 T59S probably benign Het
Lig3 C T 11: 82,790,622 T481M probably damaging Het
Lrfn1 A T 7: 28,459,732 I359F probably damaging Het
Lrp1b A T 2: 41,960,714 C90* probably null Het
Micall2 T G 5: 139,717,556 probably null Het
Mtmr3 G T 11: 4,491,037 L539I probably damaging Het
Obscn C A 11: 59,034,136 probably null Het
Olfml3 T C 3: 103,736,259 T269A probably benign Het
Olfr1217 C T 2: 89,023,890 G38R Het
Oprl1 C T 2: 181,718,661 A170V possibly damaging Het
Pdgfrb G A 18: 61,065,726 V319M possibly damaging Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Pkd2 T C 5: 104,466,975 F228L probably damaging Het
Pkhd1 T A 1: 20,612,729 D83V possibly damaging Het
Plcl1 A G 1: 55,695,833 D111G probably damaging Het
Plpp2 A G 10: 79,527,868 S162P probably damaging Het
Prex2 T A 1: 11,185,927 I1174K probably benign Het
Prkdc T A 16: 15,667,601 Y431N possibly damaging Het
Pter A G 2: 12,980,300 D147G probably benign Het
Rbsn T C 6: 92,201,764 D134G possibly damaging Het
Rnf220 T C 4: 117,296,142 D299G probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Slc7a4 T A 16: 17,573,407 N593I probably damaging Het
Speg T C 1: 75,422,508 S2200P probably benign Het
Tle1 A T 4: 72,122,359 H654Q probably benign Het
Ttll6 G A 11: 96,135,762 R124H probably damaging Het
Vmn2r111 A G 17: 22,559,151 C516R probably damaging Het
Vmn2r89 T C 14: 51,455,831 S213P probably damaging Het
Washc4 A G 10: 83,560,523 N399S probably benign Het
Wdr37 G A 13: 8,847,627 H198Y Het
Zfp407 A G 18: 84,562,454 L178P probably benign Het
Zfp882 C T 8: 71,914,987 H553Y probably damaging Het
Zfp956 T C 6: 47,963,436 V243A probably benign Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
R8897:Scn2a UTSW 2 65715658 critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65763670 missense probably damaging 0.99
R8992:Scn2a UTSW 2 65763898 missense probably damaging 1.00
R9190:Scn2a UTSW 2 65681002 missense probably benign 0.00
R9206:Scn2a UTSW 2 65717787 missense probably damaging 1.00
R9355:Scn2a UTSW 2 65764089 missense probably damaging 1.00
R9529:Scn2a UTSW 2 65764588 missense probably damaging 0.99
R9567:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R9569:Scn2a UTSW 2 65730278 missense probably damaging 1.00
R9657:Scn2a UTSW 2 65735688 missense probably damaging 1.00
R9715:Scn2a UTSW 2 65748805 missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65735686 missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCGAGCTTACAGACGCTATC -3'
(R):5'- TGTCTGGTTATAGGCACTGACC -3'

Sequencing Primer
(F):5'- GCTTACAGACGCTATCTTCTGAAAC -3'
(R):5'- CTGGTTATAGGCACTGACCTTAAG -3'
Posted On 2022-06-15