Mutagenetix > Incidental Mutation

Incidental Mutation 'R9612:Dnah9'

724326

Institutional Source

Beutler Lab

Gene Symbol

Dnah9

Ensembl Gene

ENSMUSG00000056752

Gene Name

dynein, axonemal, heavy chain 9

Synonyms

D11Ertd686e, Dnahc9

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.272) question?

Stock #

R9612 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65831282-66168551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65927649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 3288 (N3288D)

Ref Sequence

ENSEMBL: ENSMUSP00000079494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080665] [ENSMUST00000130739]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080665
AA Change: N3288D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: N3288D

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	209	787	3.6e-164	PFAM
coiled coil region	788	820	N/A	INTRINSIC
low complexity region	1228	1240	N/A	INTRINSIC
Pfam:DHC_N2	1290	1699	1.4e-134	PFAM
AAA	1863	1999	4.9e-1	SMART
AAA	2141	2341	1.99e0	SMART
AAA	2468	2614	6.75e-1	SMART
Pfam:AAA_8	2786	3053	1.1e-165	PFAM
Pfam:MT	3065	3408	7.2e-208	PFAM
Pfam:AAA_9	3430	3652	3.2e-87	PFAM
Pfam:Dynein_heavy	3786	4482	1e-241	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130739
AA Change: N104D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116227
Gene: ENSMUSG00000056752
AA Change: N104D

Domain	Start	End	E-Value	Type
Pfam:MT	1	172	7e-100	PFAM
Pfam:AAA_9	179	279	7.2e-59	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: N837D

Domain	Start	End	E-Value	Type
Pfam:AAA_7	1	258	3e-155	PFAM
Pfam:AAA_8	336	603	3.9e-166	PFAM
Pfam:MT	615	958	2.3e-208	PFAM
Pfam:AAA_9	980	1202	1.1e-87	PFAM
Pfam:Dynein_heavy	1336	1514	2.4e-52	PFAM
Pfam:Dynein_heavy	1508	1956	8.6e-155	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	A	T	16: 90,927,387	M166K	probably benign	Het
2610021A01Rik	T	C	7: 41,626,903	S677P	possibly damaging	Het
4931406P16Rik	A	T	7: 34,248,231	C451S	probably damaging	Het
4932415D10Rik	T	A	10: 82,289,619	N2519I	possibly damaging	Het
5730480H06Rik	A	G	5: 48,374,530	I67V	probably benign	Het
Adam15	T	A	3: 89,341,940	Y736F	probably damaging	Het
Adam29	A	T	8: 55,872,083	F445L	possibly damaging	Het
Adgrv1	A	G	13: 81,492,963	Y3318H	probably damaging	Het
Akap6	A	G	12: 52,911,907	Y815C	probably damaging	Het
Ankar	T	A	1: 72,665,135	D876V	possibly damaging	Het
Atp6v1g2	G	A	17: 35,237,757	V106I	probably benign	Het
Bdp1	A	G	13: 100,077,862	S490P	probably benign	Het
Bet1	A	T	6: 4,077,918	V107D	probably damaging	Het
Bri3bp	T	C	5: 125,454,326	V112A	probably damaging	Het
Cage1	T	A	13: 38,032,375	D33V	probably damaging	Het
Ccdc146	G	T	5: 21,330,579	A159E	probably damaging	Het
Ccnl1	C	A	3: 65,957,983	G49V	probably damaging	Het
Cdk13	A	C	13: 17,751,855	F787V		Het
Cdk5r1	T	C	11: 80,477,654	V49A	probably benign	Het
Cdon	G	A	9: 35,486,905	V973I	probably damaging	Het
Chd1l	T	A	3: 97,581,147	K518*	probably null	Het
Col24a1	A	G	3: 145,545,205	D1653G	probably benign	Het
Cstf3	G	T	2: 104,653,025	V359F	possibly damaging	Het
Dchs2	T	C	3: 83,270,886	I1082T	probably damaging	Het
Dlec1	A	T	9: 119,127,465	I736F	probably damaging	Het
Ehbp1	T	C	11: 22,169,124	D182G	probably damaging	Het
Evc2	G	T	5: 37,386,786	E626D	probably benign	Het
Evi5	T	C	5: 107,795,712	E589G	probably benign	Het
Exoc4	T	C	6: 33,249,226	I25T	probably benign	Het
Extl2	T	A	3: 116,027,496	*331R	probably null	Het
Fkbp8	G	A	8: 70,531,674	R225H	probably damaging	Het
Foxred2	A	T	15: 77,952,006	S384T	probably damaging	Het
Glmn	T	C	5: 107,593,865	E18G	probably damaging	Het
Gm17018	G	T	19: 45,571,983	E82*	probably null	Het
Gm21936	A	G	12: 87,795,737	I76V	probably benign	Het
Gm7489	C	A	15: 53,885,972	Q147K	unknown	Het
Gm7489	A	C	15: 53,885,973	Q147P	unknown	Het
Gm8005	T	A	14: 42,438,398	I94F		Het
Golgb1	G	A	16: 36,919,605	V2810M	probably benign	Het
Gpr21	T	C	2: 37,518,387	L315P	probably damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
Herc6	T	G	6: 57,652,032	S643A	probably benign	Het
Igkv14-100	T	A	6: 68,519,333	I70N	probably damaging	Het
Kcnn3	A	G	3: 89,609,396	M371V	probably benign	Het
Kif1a	T	A	1: 93,025,694	H1256L	probably damaging	Het
Klhdc4	A	G	8: 121,801,178	S266P	possibly damaging	Het
Kmt2d	CTGTTG	CTG	15: 98,845,176		probably benign	Het
Lefty2	T	A	1: 180,894,721	L208Q	probably damaging	Het
Lingo2	T	C	4: 35,708,450	Y510C	probably damaging	Het
Lrif1	T	A	3: 106,731,884	V70D	probably damaging	Het
Lrrc74a	A	T	12: 86,758,571	K389I	possibly damaging	Het
Megf8	A	T	7: 25,355,063	E1868V	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mmp8	A	G	9: 7,560,607	D95G	probably damaging	Het
Mmrn1	T	A	6: 60,976,424	I563N	probably damaging	Het
Mroh3	T	C	1: 136,190,975	T535A	probably benign	Het
Mroh9	A	G	1: 163,038,929	L715P	probably damaging	Het
Myh6	G	T	14: 54,963,597	A136E	probably benign	Het
Myom1	G	T	17: 71,105,480	E1231*	probably null	Het
Nod2	G	T	8: 88,670,473	C837F	probably benign	Het
Nos2	T	A	11: 78,949,158	W698R	probably damaging	Het
Nup210l	C	T	3: 90,199,866	P1570L	probably benign	Het
Oas1a	A	T	5: 120,901,965	S188T	possibly damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1440	A	T	19: 12,394,619	M119L	probably damaging	Het
Olfr396-ps1	T	A	11: 73,928,549	D108E	possibly damaging	Het
Olfr490	A	G	7: 108,286,280	M282T	probably benign	Het
Olfr836	T	A	9: 19,121,464	S167T	probably benign	Het
Olfr847	A	G	9: 19,375,381	S167P	possibly damaging	Het
Opa1	T	C	16: 29,611,437	M394T		Het
Oxct2a	T	A	4: 123,323,336	D84V	probably damaging	Het
Oxct2b	A	C	4: 123,117,226	D313A	probably damaging	Het
Phldb3	G	A	7: 24,628,947	V639M	probably damaging	Het
Plppr4	T	A	3: 117,321,961	N749I	probably benign	Het
Pmp22	G	T	11: 63,133,239	V25F	probably benign	Het
Pofut2	A	T	10: 77,265,929	M267L	probably benign	Het
Ppp1r42	T	A	1: 9,968,842	N351I	possibly damaging	Het
Prl2b1	T	C	13: 27,388,496	E37G	probably benign	Het
Ptpro	G	T	6: 137,414,320	V813F	probably benign	Het
Rnaseh2c	T	C	19: 5,602,315	F99L	probably benign	Het
Scn9a	T	A	2: 66,533,364	I857F	probably damaging	Het
Slf1	A	G	13: 77,049,085		probably null	Het
Smyd2	T	C	1: 189,880,786	*434W	probably null	Het
Stk40	A	G	4: 126,136,857	D290G	probably damaging	Het
Tdo2	C	A	3: 81,971,694	W82C	probably damaging	Het
Tmem101	A	G	11: 102,153,368	V231A	probably damaging	Het
Tns2	G	A	15: 102,107,142	E160K	probably damaging	Het
Trim31	A	T	17: 36,901,659	D174V	probably benign	Het
Unc13d	A	T	11: 116,070,318	Y404*	probably null	Het
Ush2a	C	A	1: 188,359,866	Y531*	probably null	Het
Vapa	G	A	17: 65,582,741	P144S	probably benign	Het
Vmn1r212	C	T	13: 22,883,273	V297M	possibly damaging	Het
Vmn2r80	A	C	10: 79,194,878	N846T	probably damaging	Het
Zfp811	A	G	17: 32,798,766	V100A	probably benign	Het
Zfp958	T	A	8: 4,628,298	C108S	probably damaging	Het
Zic5	G	A	14: 122,459,688	T505I	unknown	Het

Other mutations in Dnah9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:Dnah9	APN	11	65841238	splice site	probably benign
IGL00805:Dnah9	APN	11	65881695	missense	probably benign	0.00
IGL00826:Dnah9	APN	11	65989942	missense	probably damaging	1.00
IGL01108:Dnah9	APN	11	65849980	missense	possibly damaging	0.93
IGL01152:Dnah9	APN	11	66072056	missense	probably damaging	1.00
IGL01353:Dnah9	APN	11	66080571	missense	probably damaging	1.00
IGL01364:Dnah9	APN	11	66155459	missense	probably damaging	1.00
IGL01479:Dnah9	APN	11	65955717	missense	probably benign	0.14
IGL01537:Dnah9	APN	11	65947680	missense	probably benign
IGL01565:Dnah9	APN	11	66033829	missense	possibly damaging	0.95
IGL01597:Dnah9	APN	11	66118830	missense	probably damaging	1.00
IGL01619:Dnah9	APN	11	65831615	nonsense	probably null
IGL01625:Dnah9	APN	11	66044645	missense	probably damaging	1.00
IGL01803:Dnah9	APN	11	66118829	missense	probably damaging	1.00
IGL01819:Dnah9	APN	11	66108126	missense	probably benign	0.33
IGL01896:Dnah9	APN	11	66130666	missense	possibly damaging	0.89
IGL01922:Dnah9	APN	11	66075034	splice site	probably benign
IGL01923:Dnah9	APN	11	66125235	splice site	probably benign
IGL02059:Dnah9	APN	11	66072958	missense	probably damaging	1.00
IGL02068:Dnah9	APN	11	66061045	missense	probably damaging	1.00
IGL02135:Dnah9	APN	11	66117492	missense	possibly damaging	0.63
IGL02146:Dnah9	APN	11	65927700	missense	probably damaging	1.00
IGL02264:Dnah9	APN	11	66080488	splice site	probably benign
IGL02325:Dnah9	APN	11	65834217	missense	probably damaging	1.00
IGL02426:Dnah9	APN	11	66125153	missense	probably benign
IGL02440:Dnah9	APN	11	65955246	missense	probably damaging	1.00
IGL02471:Dnah9	APN	11	65947618	nonsense	probably null
IGL02496:Dnah9	APN	11	66029363	missense	probably damaging	1.00
IGL02672:Dnah9	APN	11	65927601	missense	probably benign	0.02
IGL02718:Dnah9	APN	11	65886640	missense	probably damaging	0.99
IGL02832:Dnah9	APN	11	66040346	missense	probably damaging	1.00
IGL02851:Dnah9	APN	11	66037744	splice site	probably benign
IGL02859:Dnah9	APN	11	65881619	splice site	probably benign
IGL02864:Dnah9	APN	11	66061003	missense	probably damaging	1.00
IGL02954:Dnah9	APN	11	66118967	missense	probably damaging	1.00
IGL02987:Dnah9	APN	11	65855272	missense	probably damaging	0.98
IGL02987:Dnah9	APN	11	65841273	missense	probably benign	0.23
IGL03160:Dnah9	APN	11	66108054	missense	probably damaging	0.98
IGL03171:Dnah9	APN	11	65981241	missense	probably benign	0.13
IGL03180:Dnah9	APN	11	65886639	missense	probably damaging	0.99
IGL03388:Dnah9	APN	11	65947542	missense	probably damaging	1.00
anarchy	UTSW	11	65955248	missense	probably damaging	0.99
sacco	UTSW	11	66168079	missense	possibly damaging	0.82
Tweed	UTSW	11	66072072	missense	probably damaging	0.99
vanzetti	UTSW	11	65855372	nonsense	probably null
IGL02837:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
PIT4280001:Dnah9	UTSW	11	66005013	missense	probably benign	0.44
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0070:Dnah9	UTSW	11	66160040	missense	probably benign	0.10
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0180:Dnah9	UTSW	11	66147290	missense	probably damaging	1.00
R0195:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R0230:Dnah9	UTSW	11	65855315	missense	probably damaging	1.00
R0243:Dnah9	UTSW	11	65911852	missense	possibly damaging	0.91
R0279:Dnah9	UTSW	11	65911789	critical splice donor site	probably null
R0288:Dnah9	UTSW	11	66025134	critical splice donor site	probably null
R0309:Dnah9	UTSW	11	66026972	splice site	probably benign
R0356:Dnah9	UTSW	11	66130562	critical splice donor site	probably null
R0403:Dnah9	UTSW	11	66084789	missense	possibly damaging	0.90
R0413:Dnah9	UTSW	11	66108135	missense	probably damaging	1.00
R0448:Dnah9	UTSW	11	65918713	splice site	probably benign
R0496:Dnah9	UTSW	11	66075135	missense	probably null	1.00
R0557:Dnah9	UTSW	11	66084666	missense	probably damaging	1.00
R0584:Dnah9	UTSW	11	65990489	missense	probably damaging	1.00
R0598:Dnah9	UTSW	11	66118877	missense	probably benign	0.02
R0599:Dnah9	UTSW	11	65965689	missense	probably damaging	1.00
R0606:Dnah9	UTSW	11	65841333	missense	probably damaging	1.00
R0666:Dnah9	UTSW	11	66085458	missense	probably benign	0.01
R0715:Dnah9	UTSW	11	66081248	splice site	probably benign
R0726:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R0737:Dnah9	UTSW	11	66107898	missense	probably damaging	1.00
R0763:Dnah9	UTSW	11	66155530	missense	probably benign	0.30
R0792:Dnah9	UTSW	11	65896001	missense	possibly damaging	0.84
R0829:Dnah9	UTSW	11	66005176	missense	probably benign	0.00
R0973:Dnah9	UTSW	11	66005837	splice site	probably null
R0974:Dnah9	UTSW	11	66005837	splice site	probably null
R1055:Dnah9	UTSW	11	66160011	missense	probably damaging	1.00
R1081:Dnah9	UTSW	11	66084877	missense	probably damaging	0.99
R1184:Dnah9	UTSW	11	66084612	critical splice donor site	probably null
R1225:Dnah9	UTSW	11	65871060	missense	possibly damaging	0.94
R1304:Dnah9	UTSW	11	65927588	missense	probably damaging	0.98
R1417:Dnah9	UTSW	11	65955747	missense	probably damaging	0.96
R1439:Dnah9	UTSW	11	65874132	missense	probably benign	0.22
R1447:Dnah9	UTSW	11	66108482	missense	possibly damaging	0.65
R1450:Dnah9	UTSW	11	65927786	missense	probably damaging	1.00
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1486:Dnah9	UTSW	11	65834272	missense	probably damaging	1.00
R1519:Dnah9	UTSW	11	65881761	missense	probably damaging	0.96
R1570:Dnah9	UTSW	11	66112330	missense	probably benign
R1617:Dnah9	UTSW	11	65895921	missense	probably damaging	1.00
R1623:Dnah9	UTSW	11	66037637	missense	probably damaging	1.00
R1626:Dnah9	UTSW	11	66085267	missense	probably benign	0.05
R1671:Dnah9	UTSW	11	65927963	missense	probably damaging	0.99
R1694:Dnah9	UTSW	11	65954824	nonsense	probably null
R1701:Dnah9	UTSW	11	65911924	missense	probably damaging	1.00
R1702:Dnah9	UTSW	11	66085195	missense	possibly damaging	0.72
R1708:Dnah9	UTSW	11	65915154	missense	probably benign	0.11
R1718:Dnah9	UTSW	11	66168079	missense	possibly damaging	0.82
R1729:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1760:Dnah9	UTSW	11	65981222	missense	probably benign	0.31
R1784:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1793:Dnah9	UTSW	11	66119594	critical splice donor site	probably null
R1801:Dnah9	UTSW	11	65955297	missense	probably damaging	0.99
R1827:Dnah9	UTSW	11	65850061	missense	probably damaging	0.97
R1836:Dnah9	UTSW	11	66118841	missense	probably benign	0.10
R1840:Dnah9	UTSW	11	65834198	nonsense	probably null
R1847:Dnah9	UTSW	11	65834386	missense	probably damaging	1.00
R1872:Dnah9	UTSW	11	66037490	missense	probably benign	0.16
R1929:Dnah9	UTSW	11	65976398	missense	probably benign	0.05
R1969:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R1971:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R2027:Dnah9	UTSW	11	65955338	missense	probably benign	0.11
R2049:Dnah9	UTSW	11	66044683	missense	probably damaging	1.00
R2064:Dnah9	UTSW	11	66145435	missense	probably benign	0.31
R2104:Dnah9	UTSW	11	66061124	missense	probably damaging	1.00
R2109:Dnah9	UTSW	11	66037585	missense	probably damaging	1.00
R2160:Dnah9	UTSW	11	66117483	missense	probably damaging	1.00
R2172:Dnah9	UTSW	11	66072779	missense	probably damaging	1.00
R2198:Dnah9	UTSW	11	65859499	missense	possibly damaging	0.50
R2271:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2272:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2396:Dnah9	UTSW	11	66085158	missense	probably benign	0.01
R2398:Dnah9	UTSW	11	65915203	missense	probably damaging	1.00
R2418:Dnah9	UTSW	11	66095415	nonsense	probably null
R2419:Dnah9	UTSW	11	66095415	nonsense	probably null
R2510:Dnah9	UTSW	11	66005169	missense	probably damaging	1.00
R2680:Dnah9	UTSW	11	66033925	missense	probably benign	0.00
R2875:Dnah9	UTSW	11	66168461	missense	possibly damaging	0.89
R2979:Dnah9	UTSW	11	66117588	missense	possibly damaging	0.89
R3236:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3237:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3433:Dnah9	UTSW	11	66075112	missense	possibly damaging	0.85
R3737:Dnah9	UTSW	11	66156908	nonsense	probably null
R3820:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3821:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3822:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3861:Dnah9	UTSW	11	66052994	splice site	probably benign
R3918:Dnah9	UTSW	11	65870974	missense	possibly damaging	0.54
R4011:Dnah9	UTSW	11	65834464	missense	probably damaging	0.98
R4044:Dnah9	UTSW	11	66133635	missense	probably benign	0.03
R4072:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4076:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4097:Dnah9	UTSW	11	65990459	missense	probably damaging	1.00
R4409:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4410:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4417:Dnah9	UTSW	11	65981214	missense	possibly damaging	0.75
R4420:Dnah9	UTSW	11	66118749	missense	probably benign	0.00
R4434:Dnah9	UTSW	11	66108075	missense	possibly damaging	0.67
R4451:Dnah9	UTSW	11	65881641	missense	probably benign	0.07
R4452:Dnah9	UTSW	11	66027082	missense	probably damaging	0.96
R4454:Dnah9	UTSW	11	66147389	missense	probably damaging	0.96
R4551:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4552:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4590:Dnah9	UTSW	11	66040392	missense	probably damaging	1.00
R4595:Dnah9	UTSW	11	66168152	missense	probably benign
R4655:Dnah9	UTSW	11	65955732	missense	probably benign	0.00
R4667:Dnah9	UTSW	11	66155531	missense	probably benign
R4718:Dnah9	UTSW	11	66085473	missense	probably benign
R4720:Dnah9	UTSW	11	66076358	missense	probably damaging	1.00
R4734:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4749:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4765:Dnah9	UTSW	11	65927726	missense	probably damaging	1.00
R4905:Dnah9	UTSW	11	65874124	nonsense	probably null
R4963:Dnah9	UTSW	11	66084611	splice site	probably null
R5074:Dnah9	UTSW	11	65850040	missense	probably damaging	1.00
R5230:Dnah9	UTSW	11	66084666	missense	probably damaging	0.99
R5262:Dnah9	UTSW	11	66112333	missense	probably benign	0.34
R5364:Dnah9	UTSW	11	65881696	missense	possibly damaging	0.93
R5370:Dnah9	UTSW	11	66029354	missense	probably damaging	1.00
R5386:Dnah9	UTSW	11	66029356	missense	probably damaging	1.00
R5389:Dnah9	UTSW	11	66095314	nonsense	probably null
R5541:Dnah9	UTSW	11	66145336	missense	probably damaging	1.00
R5560:Dnah9	UTSW	11	65881740	missense	probably benign	0.00
R5576:Dnah9	UTSW	11	65834096	splice site	probably null
R5648:Dnah9	UTSW	11	65927755	missense	probably benign	0.00
R5653:Dnah9	UTSW	11	65849980	missense	probably damaging	0.99
R5713:Dnah9	UTSW	11	66025223	missense	possibly damaging	0.92
R5763:Dnah9	UTSW	11	65955239	missense	probably damaging	1.00
R5825:Dnah9	UTSW	11	66126601	missense	probably benign	0.01
R5831:Dnah9	UTSW	11	66108121	missense	probably benign	0.00
R5847:Dnah9	UTSW	11	66095240	frame shift	probably null
R5870:Dnah9	UTSW	11	66085210	missense	probably benign	0.01
R5902:Dnah9	UTSW	11	66025187	missense	probably benign	0.08
R5918:Dnah9	UTSW	11	65834199	missense	probably damaging	1.00
R5979:Dnah9	UTSW	11	65834481	missense	probably damaging	1.00
R6065:Dnah9	UTSW	11	65855338	missense	probably benign	0.05
R6065:Dnah9	UTSW	11	66145397	missense	possibly damaging	0.65
R6086:Dnah9	UTSW	11	65989915	missense	probably damaging	0.99
R6086:Dnah9	UTSW	11	66085174	missense	probably benign
R6102:Dnah9	UTSW	11	65990516	missense	probably damaging	0.97
R6120:Dnah9	UTSW	11	66147399	missense	probably benign
R6154:Dnah9	UTSW	11	65855338	missense	probably benign	0.00
R6262:Dnah9	UTSW	11	65881805	splice site	probably null
R6265:Dnah9	UTSW	11	66168094	missense	probably benign	0.04
R6290:Dnah9	UTSW	11	65841375	missense	probably damaging	1.00
R6345:Dnah9	UTSW	11	66037693	missense	probably damaging	0.97
R6357:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
R6534:Dnah9	UTSW	11	65955248	missense	probably damaging	0.99
R6574:Dnah9	UTSW	11	66168281	missense	probably benign	0.37
R6582:Dnah9	UTSW	11	66061097	missense	probably damaging	1.00
R6700:Dnah9	UTSW	11	65955366	missense	probably damaging	1.00
R6800:Dnah9	UTSW	11	66072739	critical splice donor site	probably null
R6812:Dnah9	UTSW	11	65981329	missense	probably damaging	0.99
R6931:Dnah9	UTSW	11	66117626	missense	possibly damaging	0.63
R6944:Dnah9	UTSW	11	66085149	missense	possibly damaging	0.91
R6958:Dnah9	UTSW	11	66076341	missense	probably damaging	1.00
R6977:Dnah9	UTSW	11	66107909	missense	probably benign	0.37
R7021:Dnah9	UTSW	11	65981231	missense	probably benign
R7161:Dnah9	UTSW	11	65855372	nonsense	probably null
R7175:Dnah9	UTSW	11	66133637	missense	probably benign	0.03
R7199:Dnah9	UTSW	11	66118944	missense	probably benign	0.04
R7231:Dnah9	UTSW	11	65965647	missense	probably damaging	1.00
R7284:Dnah9	UTSW	11	65990476	missense	probably damaging	0.99
R7314:Dnah9	UTSW	11	65989851	missense	probably benign	0.00
R7350:Dnah9	UTSW	11	66080578	missense	probably damaging	1.00
R7420:Dnah9	UTSW	11	66117407	critical splice donor site	probably null
R7427:Dnah9	UTSW	11	65955219	missense	probably benign
R7477:Dnah9	UTSW	11	65992731	missense	probably damaging	0.98
R7515:Dnah9	UTSW	11	65841414	missense	probably benign	0.01
R7521:Dnah9	UTSW	11	65989837	missense	probably damaging	0.98
R7573:Dnah9	UTSW	11	66125215	missense	probably benign	0.43
R7659:Dnah9	UTSW	11	65989780	missense	probably damaging	0.99
R7707:Dnah9	UTSW	11	66118958	missense	probably damaging	1.00
R7749:Dnah9	UTSW	11	65911830	missense	probably damaging	1.00
R7792:Dnah9	UTSW	11	65850013	missense	probably damaging	1.00
R7808:Dnah9	UTSW	11	66005805	nonsense	probably null
R7814:Dnah9	UTSW	11	66005660	missense	probably damaging	1.00
R7818:Dnah9	UTSW	11	66025211	missense	possibly damaging	0.64
R7890:Dnah9	UTSW	11	66072072	missense	probably damaging	0.99
R7976:Dnah9	UTSW	11	65841401	missense	possibly damaging	0.91
R8121:Dnah9	UTSW	11	66017375	missense	probably benign	0.02
R8232:Dnah9	UTSW	11	65855323	missense	possibly damaging	0.91
R8311:Dnah9	UTSW	11	65989818	missense	probably benign	0.00
R8326:Dnah9	UTSW	11	66117626	missense	probably benign	0.01
R8338:Dnah9	UTSW	11	65841241	critical splice donor site	probably null
R8356:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8456:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8468:Dnah9	UTSW	11	65831730	missense	probably benign	0.00
R8721:Dnah9	UTSW	11	66095298	missense	probably damaging	1.00
R8747:Dnah9	UTSW	11	65927990	missense	possibly damaging	0.69
R8798:Dnah9	UTSW	11	65905231	missense	probably damaging	0.99
R8806:Dnah9	UTSW	11	65859483	missense	probably damaging	1.00
R8826:Dnah9	UTSW	11	65849916	missense	probably benign	0.13
R8837:Dnah9	UTSW	11	65855234	missense	possibly damaging	0.72
R8886:Dnah9	UTSW	11	66053014	missense	probably damaging	1.00
R8887:Dnah9	UTSW	11	65855384	missense	probably benign	0.01
R8921:Dnah9	UTSW	11	65911921	missense	probably benign
R8933:Dnah9	UTSW	11	65855252	missense	possibly damaging	0.88
R8949:Dnah9	UTSW	11	66168400	missense	possibly damaging	0.91
R8967:Dnah9	UTSW	11	66125112	critical splice donor site	probably null
R8979:Dnah9	UTSW	11	66005152	missense	probably benign
R8991:Dnah9	UTSW	11	65886680	missense	probably damaging	0.96
R9016:Dnah9	UTSW	11	66108030	missense	probably damaging	0.99
R9025:Dnah9	UTSW	11	66005825	missense	probably damaging	1.00
R9043:Dnah9	UTSW	11	65954854	missense
R9047:Dnah9	UTSW	11	66072099	missense	possibly damaging	0.89
R9076:Dnah9	UTSW	11	66117638	missense	probably benign	0.21
R9113:Dnah9	UTSW	11	65989887	missense	probably damaging	1.00
R9152:Dnah9	UTSW	11	66130631	missense	probably damaging	1.00
R9187:Dnah9	UTSW	11	66005146	missense	probably benign
R9198:Dnah9	UTSW	11	65955744	missense	probably benign	0.02
R9203:Dnah9	UTSW	11	65855287	missense	possibly damaging	0.58
R9234:Dnah9	UTSW	11	66033925	missense	possibly damaging	0.68
R9245:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R9265:Dnah9	UTSW	11	65841255	missense	probably benign	0.01
R9307:Dnah9	UTSW	11	66085474	missense	probably benign	0.14
R9336:Dnah9	UTSW	11	65870949	missense	probably damaging	1.00
R9386:Dnah9	UTSW	11	65947542	missense	probably damaging	1.00
R9498:Dnah9	UTSW	11	65848373	missense	probably damaging	0.99
R9508:Dnah9	UTSW	11	65834263	missense	probably damaging	1.00
R9524:Dnah9	UTSW	11	66085483	missense	possibly damaging	0.92
R9577:Dnah9	UTSW	11	65976521	missense	probably benign	0.00
R9583:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R9587:Dnah9	UTSW	11	66108391	missense	probably null	0.92
R9748:Dnah9	UTSW	11	66085464	missense	possibly damaging	0.51
R9749:Dnah9	UTSW	11	66095376	missense	probably damaging	1.00
R9759:Dnah9	UTSW	11	66075118	missense	probably null	0.93
R9784:Dnah9	UTSW	11	66085134	missense	probably damaging	0.99
V3553:Dnah9	UTSW	11	65970076	missense	probably damaging	1.00
X0027:Dnah9	UTSW	11	66085479	missense	probably benign	0.07
X0028:Dnah9	UTSW	11	65990452	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65895972	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65927853	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65970084	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66037474	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66072835	missense	probably damaging	1.00
Z1177:Dnah9	UTSW	11	66126650	missense	probably damaging	1.00
Z1186:Dnah9	UTSW	11	66085174	missense	probably benign
Z1186:Dnah9	UTSW	11	66147381	missense	probably benign
Z1187:Dnah9	UTSW	11	66085174	missense	probably benign
Z1187:Dnah9	UTSW	11	66147381	missense	probably benign
Z1188:Dnah9	UTSW	11	66085174	missense	probably benign
Z1188:Dnah9	UTSW	11	66147381	missense	probably benign
Z1189:Dnah9	UTSW	11	66085174	missense	probably benign
Z1189:Dnah9	UTSW	11	66147381	missense	probably benign
Z1190:Dnah9	UTSW	11	66085174	missense	probably benign
Z1190:Dnah9	UTSW	11	66147381	missense	probably benign
Z1191:Dnah9	UTSW	11	66085174	missense	probably benign
Z1191:Dnah9	UTSW	11	66147381	missense	probably benign
Z1192:Dnah9	UTSW	11	66085174	missense	probably benign
Z1192:Dnah9	UTSW	11	66147381	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGTTGTCCGTGTTGAAAAGG -3'
(R):5'- TCCACTTCGACAAGGAGAAC -3'

Sequencing Primer
(F):5'- AAGGGATGGATTTCTGCATTAAC -3'
(R):5'- GGAGAACATTCATGAGAATTGCCTC -3'

Posted On

2022-09-12