Incidental Mutation 'R9624:Wapl'
ID 725058
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9624 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34673928-34747983 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34692106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 308 (N308K)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: N308K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: N308K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: N308K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: N308K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: N308K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: N308K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,545,450 N481I probably damaging Het
Ahnak T A 19: 9,012,482 L3710Q unknown Het
Anapc15-ps T C 10: 95,673,103 D105G probably benign Het
Ankfn1 T C 11: 89,523,207 N114S probably benign Het
Ankrd27 A T 7: 35,602,466 T137S possibly damaging Het
Atp1b3 A G 9: 96,340,240 S165P probably benign Het
Atxn7l3 T C 11: 102,292,026 D256G probably benign Het
B430305J03Rik C A 3: 61,363,987 L112F unknown Het
Bub1 A T 2: 127,804,846 I838K probably damaging Het
C3 T A 17: 57,220,189 E753D probably benign Het
Cacnb4 T C 2: 52,474,930 D107G probably benign Het
Cenpj A T 14: 56,564,930 H59Q probably benign Het
Cxxc1 A T 18: 74,219,441 H364L possibly damaging Het
Dapk1 T C 13: 60,748,123 I675T probably benign Het
Eln A G 5: 134,710,137 S663P unknown Het
Epha8 G T 4: 136,931,754 P863Q probably damaging Het
Erich6 G T 3: 58,629,345 T278N possibly damaging Het
Fam47e G C 5: 92,578,536 R111P probably benign Het
Fam83g C T 11: 61,684,502 probably benign Het
Fam84b A T 15: 60,823,144 I251N probably damaging Het
Fanci A T 7: 79,435,369 I848L probably benign Het
Foxj3 T A 4: 119,626,392 D620E unknown Het
Gm14443 T A 2: 175,170,336 N106Y possibly damaging Het
Gm17654 T C 14: 43,578,035 D105G Het
Gps1 C A 11: 120,786,608 A216D probably damaging Het
Hs3st3b1 T C 11: 63,889,284 K339R probably benign Het
Ikzf1 A G 11: 11,769,219 T396A probably damaging Het
Lrrc9 A G 12: 72,450,812 I135V probably benign Het
Mylk C A 16: 34,879,307 Q347K probably benign Het
Myo1e A G 9: 70,395,874 Y1059C probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr1385 T A 11: 49,495,007 I158N possibly damaging Het
Olfr149 A G 9: 39,702,526 F81S probably benign Het
Olfr218 A T 1: 173,204,105 I250F probably benign Het
Olfr820 T C 10: 130,017,997 V212A possibly damaging Het
Olfr937 T A 9: 39,060,157 N170Y probably benign Het
Olfr948 G T 9: 39,319,552 Q21K probably benign Het
Papd7 A T 13: 69,503,668 W545R probably damaging Het
Piezo2 G A 18: 63,064,696 P1590S possibly damaging Het
Prl7a2 T A 13: 27,665,886 K68* probably null Het
Prss33 A G 17: 23,835,682 V14A probably benign Het
Rad17 T C 13: 100,636,995 N162S probably damaging Het
Sbf2 A T 7: 110,364,650 V1042E probably damaging Het
Scn1a A T 2: 66,323,422 M689K probably benign Het
Senp7 A T 16: 56,169,712 I608F probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGGACCAGCTCAGCCACG GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG 7: 126,467,572 probably benign Het
Sh2b1 AGCTCAGCCACGGGGAC AGCTCAGCCACGGGGACACGCTCAGCCACGGGGAC 7: 126,467,578 probably benign Het
Slc38a3 A G 9: 107,655,311 V370A probably damaging Het
Sorbs2 A G 8: 45,775,653 I307V possibly damaging Het
Spata13 C T 14: 60,706,900 P581S probably benign Het
Spindoc G A 19: 7,374,832 T50M probably benign Het
Sppl2b T A 10: 80,863,539 F269Y probably benign Het
Stab1 C T 14: 31,141,388 V2114M Het
Tcerg1l A G 7: 138,394,194 V195A possibly damaging Het
Tmem128 G T 5: 38,264,892 R105L possibly damaging Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Vmn1r194 T A 13: 22,244,501 I96N probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r78 G A 7: 12,152,483 S7N probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
R8988:Wapl UTSW 14 34729182 missense probably damaging 1.00
R9072:Wapl UTSW 14 34677460 missense possibly damaging 0.81
R9197:Wapl UTSW 14 34722287 missense probably damaging 1.00
R9259:Wapl UTSW 14 34741095 missense probably benign 0.00
R9545:Wapl UTSW 14 34677093 missense probably damaging 1.00
R9613:Wapl UTSW 14 34731563 missense probably benign 0.29
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGTTGTCCAGTCAAAGGATCTG -3'
(R):5'- GTAATCTCTAGTCCGTCCAACTG -3'

Sequencing Primer
(F):5'- TCCAGTCAAAGGATCTGTAAGAACTG -3'
(R):5'- GTCCAACTGTTCCTCGAAAACTGG -3'
Posted On 2022-09-12