Incidental Mutation 'R9624:Wapl'
ID 725058
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9624 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34414063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 308 (N308K)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: N308K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: N308K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: N308K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: N308K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: N308K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: N308K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,509,070 (GRCm39) N481I probably damaging Het
Ahnak T A 19: 8,989,846 (GRCm39) L3710Q unknown Het
Anapc15-ps T C 10: 95,508,965 (GRCm39) D105G probably benign Het
Ankfn1 T C 11: 89,414,033 (GRCm39) N114S probably benign Het
Ankrd27 A T 7: 35,301,891 (GRCm39) T137S possibly damaging Het
Atp1b3 A G 9: 96,222,293 (GRCm39) S165P probably benign Het
Atxn7l3 T C 11: 102,182,852 (GRCm39) D256G probably benign Het
B430305J03Rik C A 3: 61,271,408 (GRCm39) L112F unknown Het
Bub1 A T 2: 127,646,766 (GRCm39) I838K probably damaging Het
C3 T A 17: 57,527,189 (GRCm39) E753D probably benign Het
Cacnb4 T C 2: 52,364,942 (GRCm39) D107G probably benign Het
Cenpj A T 14: 56,802,387 (GRCm39) H59Q probably benign Het
Cxxc1 A T 18: 74,352,512 (GRCm39) H364L possibly damaging Het
Dapk1 T C 13: 60,895,937 (GRCm39) I675T probably benign Het
Eln A G 5: 134,738,991 (GRCm39) S663P unknown Het
Epha8 G T 4: 136,659,065 (GRCm39) P863Q probably damaging Het
Erich6 G T 3: 58,536,766 (GRCm39) T278N possibly damaging Het
Fam47e G C 5: 92,726,395 (GRCm39) R111P probably benign Het
Fam83g C T 11: 61,575,328 (GRCm39) probably benign Het
Fanci A T 7: 79,085,117 (GRCm39) I848L probably benign Het
Foxj3 T A 4: 119,483,589 (GRCm39) D620E unknown Het
Gm14443 T A 2: 175,012,129 (GRCm39) N106Y possibly damaging Het
Gm17654 T C 14: 43,815,492 (GRCm39) D105G Het
Gps1 C A 11: 120,677,434 (GRCm39) A216D probably damaging Het
Hs3st3b1 T C 11: 63,780,110 (GRCm39) K339R probably benign Het
Ikzf1 A G 11: 11,719,219 (GRCm39) T396A probably damaging Het
Lratd2 A T 15: 60,694,993 (GRCm39) I251N probably damaging Het
Lrrc9 A G 12: 72,497,586 (GRCm39) I135V probably benign Het
Mylk C A 16: 34,699,677 (GRCm39) Q347K probably benign Het
Myo1e A G 9: 70,303,156 (GRCm39) Y1059C probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Or10d1b A G 9: 39,613,822 (GRCm39) F81S probably benign Het
Or10j3 A T 1: 173,031,672 (GRCm39) I250F probably benign Het
Or2y1 T A 11: 49,385,834 (GRCm39) I158N possibly damaging Het
Or6c33 T C 10: 129,853,866 (GRCm39) V212A possibly damaging Het
Or8g23 T A 9: 38,971,453 (GRCm39) N170Y probably benign Het
Or8g30 G T 9: 39,230,848 (GRCm39) Q21K probably benign Het
Piezo2 G A 18: 63,197,767 (GRCm39) P1590S possibly damaging Het
Prl7a2 T A 13: 27,849,869 (GRCm39) K68* probably null Het
Prss33 A G 17: 24,054,656 (GRCm39) V14A probably benign Het
Rad17 T C 13: 100,773,503 (GRCm39) N162S probably damaging Het
Sbf2 A T 7: 109,963,857 (GRCm39) V1042E probably damaging Het
Scn1a A T 2: 66,153,766 (GRCm39) M689K probably benign Het
Senp7 A T 16: 55,990,075 (GRCm39) I608F probably damaging Het
Sh2b1 GGGACCAGCTCAGCCACG GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG 7: 126,066,744 (GRCm39) probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 AGCTCAGCCACGGGGAC AGCTCAGCCACGGGGACACGCTCAGCCACGGGGAC 7: 126,066,750 (GRCm39) probably benign Het
Slc38a3 A G 9: 107,532,510 (GRCm39) V370A probably damaging Het
Sorbs2 A G 8: 46,228,690 (GRCm39) I307V possibly damaging Het
Spata13 C T 14: 60,944,349 (GRCm39) P581S probably benign Het
Spindoc G A 19: 7,352,197 (GRCm39) T50M probably benign Het
Sppl2b T A 10: 80,699,373 (GRCm39) F269Y probably benign Het
Stab1 C T 14: 30,863,345 (GRCm39) V2114M Het
Tcerg1l A G 7: 137,995,923 (GRCm39) V195A possibly damaging Het
Tent4a A T 13: 69,651,787 (GRCm39) W545R probably damaging Het
Tmem128 G T 5: 38,422,236 (GRCm39) R105L possibly damaging Het
Tns3 G A 11: 8,401,142 (GRCm39) T1052M possibly damaging Het
Vmn1r194 T A 13: 22,428,671 (GRCm39) I96N probably damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r78 G A 7: 11,886,410 (GRCm39) S7N probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AGTTGTCCAGTCAAAGGATCTG -3'
(R):5'- GTAATCTCTAGTCCGTCCAACTG -3'

Sequencing Primer
(F):5'- TCCAGTCAAAGGATCTGTAAGAACTG -3'
(R):5'- GTCCAACTGTTCCTCGAAAACTGG -3'
Posted On 2022-09-12