Incidental Mutation 'R0836:Kcnd2'
ID 77900
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 21215502-21729804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21727328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 627 (V627E)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably damaging
Transcript: ENSMUST00000081542
AA Change: V627E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: V627E

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rbp3 T G 14: 33,678,595 (GRCm39) S848A possibly damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21,714,153 (GRCm39) missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21,217,216 (GRCm39) missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21,727,339 (GRCm39) makesense probably null
IGL01534:Kcnd2 APN 6 21,726,144 (GRCm39) missense probably benign
IGL02623:Kcnd2 APN 6 21,726,194 (GRCm39) missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21,216,924 (GRCm39) nonsense probably null
IGL02874:Kcnd2 APN 6 21,216,922 (GRCm39) missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21,217,148 (GRCm39) missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21,216,554 (GRCm39) missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21,216,508 (GRCm39) nonsense probably null
IGL03154:Kcnd2 APN 6 21,216,707 (GRCm39) missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21,216,515 (GRCm39) missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21,714,208 (GRCm39) missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21,216,682 (GRCm39) missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21,216,441 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,726,238 (GRCm39) splice site probably benign
R0884:Kcnd2 UTSW 6 21,216,540 (GRCm39) missense probably benign
R1434:Kcnd2 UTSW 6 21,216,356 (GRCm39) missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21,216,431 (GRCm39) missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21,217,262 (GRCm39) nonsense probably null
R3939:Kcnd2 UTSW 6 21,217,095 (GRCm39) missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21,216,896 (GRCm39) missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21,216,395 (GRCm39) missense probably benign
R4707:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5523:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5545:Kcnd2 UTSW 6 21,217,018 (GRCm39) missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21,217,084 (GRCm39) missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21,216,587 (GRCm39) missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21,216,707 (GRCm39) missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21,216,177 (GRCm39) start gained probably benign
R7183:Kcnd2 UTSW 6 21,216,436 (GRCm39) missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21,216,777 (GRCm39) missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21,216,497 (GRCm39) missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21,217,073 (GRCm39) missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21,726,197 (GRCm39) nonsense probably null
R8465:Kcnd2 UTSW 6 21,216,695 (GRCm39) missense probably damaging 1.00
R9329:Kcnd2 UTSW 6 21,725,981 (GRCm39) missense probably damaging 1.00
R9532:Kcnd2 UTSW 6 21,727,180 (GRCm39) missense probably benign 0.16
R9766:Kcnd2 UTSW 6 21,216,367 (GRCm39) missense probably benign 0.20
X0021:Kcnd2 UTSW 6 21,217,322 (GRCm39) missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21,216,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGAAGCCTCTCAAAGCCTC -3'
(R):5'- AGGTTGAACGCTGTCTAGAAATGCC -3'

Sequencing Primer
(F):5'- AGTGGCTTCAAATATGGTATCGC -3'
(R):5'- ACGCTGTCTAGAAATGCCTTTTG -3'
Posted On 2013-10-16