Incidental Mutation 'R0836:Otog'
ID 77911
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Name otogelin
Synonyms Otgn
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45890411-45960858 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45918786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 954 (T954I)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000164538
AA Change: T954I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: T954I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Meta Mutation Damage Score 0.1019 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Kcnd2 T C 6: 21,726,238 (GRCm39) probably benign Het
Kcnd2 T A 6: 21,727,328 (GRCm39) V627E probably damaging Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rbp3 T G 14: 33,678,595 (GRCm39) S848A possibly damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 45,900,706 (GRCm39) missense probably damaging 1.00
IGL00725:Otog APN 7 45,923,516 (GRCm39) missense probably damaging 1.00
IGL00757:Otog APN 7 45,939,552 (GRCm39) missense probably damaging 1.00
IGL00822:Otog APN 7 45,945,304 (GRCm39) missense probably benign 0.24
IGL01354:Otog APN 7 45,939,150 (GRCm39) missense probably damaging 1.00
IGL01567:Otog APN 7 45,926,039 (GRCm39) splice site probably benign
IGL02034:Otog APN 7 45,945,417 (GRCm39) nonsense probably null
IGL02090:Otog APN 7 45,949,571 (GRCm39) missense probably damaging 1.00
IGL02132:Otog APN 7 45,954,903 (GRCm39) missense probably damaging 0.99
IGL02148:Otog APN 7 45,950,011 (GRCm39) missense probably damaging 1.00
IGL02173:Otog APN 7 45,926,165 (GRCm39) splice site probably benign
IGL02199:Otog APN 7 45,926,775 (GRCm39) missense possibly damaging 0.90
IGL02216:Otog APN 7 45,950,892 (GRCm39) missense probably damaging 1.00
IGL02322:Otog APN 7 45,950,881 (GRCm39) missense probably benign 0.01
IGL02330:Otog APN 7 45,937,493 (GRCm39) missense possibly damaging 0.84
IGL02529:Otog APN 7 45,909,381 (GRCm39) missense probably damaging 0.99
IGL02898:Otog APN 7 45,959,562 (GRCm39) missense probably damaging 1.00
IGL02970:Otog APN 7 45,945,291 (GRCm39) missense probably benign 0.11
IGL03085:Otog APN 7 45,955,346 (GRCm39) critical splice donor site probably null
IGL03108:Otog APN 7 45,900,762 (GRCm39) missense probably damaging 1.00
IGL03275:Otog APN 7 45,955,654 (GRCm39) missense probably damaging 1.00
R0282_Otog_616 UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0636_otog_678 UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R1029_otog_141 UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
BB010:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
BB020:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
I1329:Otog UTSW 7 45,895,927 (GRCm39) missense probably benign 0.02
IGL02984:Otog UTSW 7 45,954,932 (GRCm39) missense probably damaging 0.98
PIT4472001:Otog UTSW 7 45,945,273 (GRCm39) missense probably damaging 1.00
R0032:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0032:Otog UTSW 7 45,937,637 (GRCm39) nonsense probably null
R0105:Otog UTSW 7 45,937,790 (GRCm39) missense possibly damaging 0.79
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0165:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0166:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0167:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0242:Otog UTSW 7 45,916,805 (GRCm39) missense probably damaging 0.98
R0242:Otog UTSW 7 45,916,805 (GRCm39) missense probably damaging 0.98
R0282:Otog UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0392:Otog UTSW 7 45,899,499 (GRCm39) missense probably benign 0.00
R0436:Otog UTSW 7 45,915,360 (GRCm39) splice site probably benign
R0441:Otog UTSW 7 45,955,301 (GRCm39) missense probably damaging 1.00
R0499:Otog UTSW 7 45,923,256 (GRCm39) missense probably damaging 1.00
R0530:Otog UTSW 7 45,947,668 (GRCm39) missense probably damaging 0.98
R0541:Otog UTSW 7 45,918,673 (GRCm39) splice site probably benign
R0600:Otog UTSW 7 45,900,819 (GRCm39) splice site probably benign
R0626:Otog UTSW 7 45,920,797 (GRCm39) missense possibly damaging 0.95
R0636:Otog UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R0764:Otog UTSW 7 45,949,918 (GRCm39) missense probably benign 0.00
R0833:Otog UTSW 7 45,918,786 (GRCm39) missense possibly damaging 0.94
R0844:Otog UTSW 7 45,937,252 (GRCm39) missense possibly damaging 0.53
R1029:Otog UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
R1116:Otog UTSW 7 45,950,025 (GRCm39) splice site probably benign
R1134:Otog UTSW 7 45,947,938 (GRCm39) missense probably damaging 1.00
R1183:Otog UTSW 7 45,939,179 (GRCm39) missense probably benign 0.41
R1204:Otog UTSW 7 45,909,335 (GRCm39) missense probably benign 0.16
R1301:Otog UTSW 7 45,939,113 (GRCm39) missense probably damaging 1.00
R1344:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1384:Otog UTSW 7 45,923,119 (GRCm39) splice site probably benign
R1418:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1432:Otog UTSW 7 45,950,007 (GRCm39) missense probably damaging 1.00
R1479:Otog UTSW 7 45,945,402 (GRCm39) missense possibly damaging 0.75
R1521:Otog UTSW 7 45,908,688 (GRCm39) missense possibly damaging 0.71
R1589:Otog UTSW 7 45,933,332 (GRCm39) missense probably benign 0.18
R1671:Otog UTSW 7 45,911,210 (GRCm39) missense probably damaging 1.00
R1773:Otog UTSW 7 45,937,583 (GRCm39) missense probably benign 0.28
R1806:Otog UTSW 7 45,940,361 (GRCm39) critical splice acceptor site probably null
R1843:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1873:Otog UTSW 7 45,918,767 (GRCm39) missense probably damaging 1.00
R1923:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1927:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R2008:Otog UTSW 7 45,913,498 (GRCm39) missense probably benign 0.43
R2048:Otog UTSW 7 45,937,063 (GRCm39) missense probably damaging 1.00
R2131:Otog UTSW 7 45,899,524 (GRCm39) missense probably damaging 1.00
R2153:Otog UTSW 7 45,952,328 (GRCm39) missense probably damaging 1.00
R2240:Otog UTSW 7 45,890,453 (GRCm39) start codon destroyed probably null
R2278:Otog UTSW 7 45,949,468 (GRCm39) missense probably damaging 1.00
R2407:Otog UTSW 7 45,890,964 (GRCm39) missense probably benign 0.10
R2424:Otog UTSW 7 45,947,593 (GRCm39) nonsense probably null
R2513:Otog UTSW 7 45,955,014 (GRCm39) critical splice donor site probably null
R2863:Otog UTSW 7 45,918,730 (GRCm39) missense probably damaging 1.00
R3148:Otog UTSW 7 45,939,593 (GRCm39) missense probably damaging 1.00
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3733:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3734:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3855:Otog UTSW 7 45,923,184 (GRCm39) missense possibly damaging 0.65
R3880:Otog UTSW 7 45,937,445 (GRCm39) missense possibly damaging 0.93
R4081:Otog UTSW 7 45,937,723 (GRCm39) missense possibly damaging 0.92
R4349:Otog UTSW 7 45,923,613 (GRCm39) missense probably damaging 0.99
R4382:Otog UTSW 7 45,939,122 (GRCm39) missense probably damaging 1.00
R4392:Otog UTSW 7 45,934,548 (GRCm39) missense probably damaging 0.98
R4520:Otog UTSW 7 45,890,477 (GRCm39) unclassified probably benign
R4569:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R4580:Otog UTSW 7 45,937,225 (GRCm39) missense possibly damaging 0.78
R4672:Otog UTSW 7 45,939,210 (GRCm39) missense probably damaging 0.98
R4764:Otog UTSW 7 45,937,943 (GRCm39) missense probably benign 0.29
R4910:Otog UTSW 7 45,947,958 (GRCm39) missense probably damaging 1.00
R4910:Otog UTSW 7 45,913,486 (GRCm39) missense probably damaging 1.00
R4913:Otog UTSW 7 45,913,526 (GRCm39) missense probably benign 0.31
R4975:Otog UTSW 7 45,937,415 (GRCm39) missense probably benign 0.00
R4996:Otog UTSW 7 45,954,934 (GRCm39) nonsense probably null
R4996:Otog UTSW 7 45,948,030 (GRCm39) missense possibly damaging 0.51
R5116:Otog UTSW 7 45,923,191 (GRCm39) missense probably benign 0.34
R5138:Otog UTSW 7 45,899,430 (GRCm39) missense possibly damaging 0.61
R5169:Otog UTSW 7 45,947,572 (GRCm39) missense probably benign 0.06
R5239:Otog UTSW 7 45,936,859 (GRCm39) missense probably benign 0.15
R5277:Otog UTSW 7 45,896,045 (GRCm39) missense possibly damaging 0.89
R5287:Otog UTSW 7 45,918,753 (GRCm39) missense probably damaging 0.98
R5299:Otog UTSW 7 45,938,275 (GRCm39) missense probably benign 0.16
R5378:Otog UTSW 7 45,904,428 (GRCm39) missense probably damaging 1.00
R5382:Otog UTSW 7 45,898,428 (GRCm39) missense probably damaging 1.00
R5487:Otog UTSW 7 45,938,192 (GRCm39) missense probably benign 0.27
R5507:Otog UTSW 7 45,911,123 (GRCm39) missense probably damaging 1.00
R5517:Otog UTSW 7 45,923,995 (GRCm39) missense probably damaging 1.00
R5643:Otog UTSW 7 45,936,871 (GRCm39) missense probably damaging 1.00
R5757:Otog UTSW 7 45,890,545 (GRCm39) critical splice donor site probably null
R5910:Otog UTSW 7 45,948,022 (GRCm39) missense possibly damaging 0.94
R6019:Otog UTSW 7 45,938,374 (GRCm39) missense probably benign 0.00
R6150:Otog UTSW 7 45,913,483 (GRCm39) missense possibly damaging 0.82
R6225:Otog UTSW 7 45,898,458 (GRCm39) missense possibly damaging 0.67
R6271:Otog UTSW 7 45,901,464 (GRCm39) missense probably damaging 1.00
R6317:Otog UTSW 7 45,950,639 (GRCm39) missense probably damaging 1.00
R6454:Otog UTSW 7 45,955,241 (GRCm39) missense probably damaging 1.00
R6640:Otog UTSW 7 45,911,167 (GRCm39) missense possibly damaging 0.92
R6753:Otog UTSW 7 45,898,495 (GRCm39) missense probably benign 0.06
R6788:Otog UTSW 7 45,947,741 (GRCm39) missense probably damaging 1.00
R6859:Otog UTSW 7 45,923,205 (GRCm39) missense probably damaging 0.96
R7033:Otog UTSW 7 45,916,822 (GRCm39) critical splice donor site probably null
R7071:Otog UTSW 7 45,916,747 (GRCm39) missense probably damaging 1.00
R7084:Otog UTSW 7 45,947,990 (GRCm39) nonsense probably null
R7116:Otog UTSW 7 45,947,689 (GRCm39) missense probably damaging 0.99
R7202:Otog UTSW 7 45,937,474 (GRCm39) missense probably damaging 0.97
R7365:Otog UTSW 7 45,947,732 (GRCm39) missense probably damaging 1.00
R7468:Otog UTSW 7 45,913,543 (GRCm39) missense probably benign
R7475:Otog UTSW 7 45,916,700 (GRCm39) missense probably damaging 0.99
R7502:Otog UTSW 7 45,948,039 (GRCm39) missense probably damaging 1.00
R7558:Otog UTSW 7 45,952,584 (GRCm39) missense probably damaging 0.99
R7577:Otog UTSW 7 45,937,279 (GRCm39) missense possibly damaging 0.62
R7651:Otog UTSW 7 45,891,185 (GRCm39) missense probably benign 0.00
R7689:Otog UTSW 7 45,901,480 (GRCm39) missense probably damaging 1.00
R7806:Otog UTSW 7 45,935,200 (GRCm39) missense probably benign
R7933:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R8021:Otog UTSW 7 45,916,766 (GRCm39) missense probably damaging 0.98
R8082:Otog UTSW 7 45,939,143 (GRCm39) missense probably damaging 1.00
R8531:Otog UTSW 7 45,901,473 (GRCm39) missense probably damaging 0.99
R8772:Otog UTSW 7 45,934,352 (GRCm39) missense probably damaging 1.00
R8816:Otog UTSW 7 45,950,905 (GRCm39) missense possibly damaging 0.92
R8842:Otog UTSW 7 45,895,948 (GRCm39) missense probably damaging 1.00
R8987:Otog UTSW 7 45,936,878 (GRCm39) missense probably benign 0.43
R8988:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R9010:Otog UTSW 7 45,949,894 (GRCm39) missense probably benign 0.00
R9025:Otog UTSW 7 45,937,520 (GRCm39) missense probably benign 0.13
R9131:Otog UTSW 7 45,952,597 (GRCm39) nonsense probably null
R9179:Otog UTSW 7 45,937,885 (GRCm39) missense possibly damaging 0.65
R9334:Otog UTSW 7 45,909,353 (GRCm39) missense possibly damaging 0.95
R9365:Otog UTSW 7 45,920,688 (GRCm39) missense probably damaging 1.00
R9408:Otog UTSW 7 45,916,721 (GRCm39) missense possibly damaging 0.79
R9418:Otog UTSW 7 45,938,024 (GRCm39) missense probably benign 0.41
R9465:Otog UTSW 7 45,955,299 (GRCm39) missense possibly damaging 0.80
R9496:Otog UTSW 7 45,890,505 (GRCm39) missense unknown
R9632:Otog UTSW 7 45,915,143 (GRCm39) missense probably benign 0.27
R9656:Otog UTSW 7 45,959,567 (GRCm39) missense probably damaging 1.00
RF024:Otog UTSW 7 45,937,093 (GRCm39) missense probably damaging 1.00
X0062:Otog UTSW 7 45,909,345 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,939,164 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,923,962 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,912,276 (GRCm39) missense possibly damaging 0.80
Z1177:Otog UTSW 7 45,959,409 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGACCCTGGGCTATTATAGGGA -3'
(R):5'- CCCCAGCCTGTCACCATTGAAA -3'

Sequencing Primer
(F):5'- caccctgaccaaaagcaac -3'
(R):5'- AATTCAACTCTCTGGCACCTG -3'
Posted On 2013-10-16