Mutagenetix > Incidental Mutation

Incidental Mutation 'R0836:Otog'

77911

Institutional Source

Beutler Lab

Gene Symbol

Otog

Ensembl Gene

ENSMUSG00000009487

Gene Name

otogelin

Synonyms

Otgn

MMRRC Submission

039015-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.570) question?

Stock #

R0836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46240987-46311434 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46269362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 954 (T954I)

Ref Sequence

ENSEMBL: ENSMUSP00000130949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164538]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164538
AA Change: T954I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: T954I

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
VWD	128	288	7.98e-45	SMART
C8	330	404	1.05e-13	SMART
VWC	463	505	1.24e0	SMART
VWD	490	655	4.94e-50	SMART
C8	693	758	1.23e-5	SMART
Pfam:TIL	767	831	3.4e-13	PFAM
VWC	935	983	1.83e0	SMART
VWD	962	1118	6.05e-45	SMART
C8	1153	1227	1.02e-34	SMART
Pfam:AbfB	1270	1384	7.5e-10	PFAM
low complexity region	1488	1513	N/A	INTRINSIC
low complexity region	1524	1536	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1637	1644	N/A	INTRINSIC
low complexity region	1677	1696	N/A	INTRINSIC
low complexity region	1731	1748	N/A	INTRINSIC
VWD	2087	2251	2.37e-29	SMART
C8	2287	2356	4.93e-19	SMART
low complexity region	2443	2449	N/A	INTRINSIC
CT	2828	2911	3.46e-28	SMART

Meta Mutation Damage Score

0.1019

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.2%

Validation Efficiency

100% (102/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aldh9a1	G	A	1: 167,350,255	G7D	probably benign	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Asphd2	A	T	5: 112,391,769	L66H	probably damaging	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cadps2	T	C	6: 23,328,776		probably benign	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Cfap43	C	A	19: 47,815,846	V304L	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Cpa5	T	C	6: 30,623,211	S124P	probably damaging	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fezf1	T	C	6: 23,246,999	H278R	probably benign	Het
Fhod3	T	A	18: 25,066,218	Y649N	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itga2	A	G	13: 114,856,679	V800A	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Kcnd2	T	C	6: 21,726,239		probably benign	Het
Kcnd2	T	A	6: 21,727,329	V627E	probably damaging	Het
Ktn1	A	G	14: 47,701,062		probably null	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Macf1	A	G	4: 123,494,882		probably null	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Nfkbia	C	A	12: 55,490,776	A211S	probably damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Pmch	A	G	10: 88,091,224	I30V	probably benign	Het
Ppat	A	C	5: 76,922,501	Y157D	probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rbp3	T	G	14: 33,956,638	S848A	possibly damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc34a2	A	G	5: 53,067,707	T397A	probably benign	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Sorcs3	G	A	19: 48,487,394	V231I	probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Stxbp5	A	T	10: 9,865,099	S116R	probably damaging	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tax1bp1	C	T	6: 52,741,940		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Thbs4	T	G	13: 92,758,038	D659A	probably damaging	Het
Tmed11	A	T	5: 108,795,309	M1K	probably null	Het
Tmpo	A	T	10: 91,161,953	C657*	probably null	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Vav3	A	G	3: 109,647,679	N81S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het
Vmn2r17	A	T	5: 109,427,956	H231L	possibly damaging	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Otog

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Otog	APN	7	46251282	missense	probably damaging	1.00
IGL00725:Otog	APN	7	46274092	missense	probably damaging	1.00
IGL00757:Otog	APN	7	46290128	missense	probably damaging	1.00
IGL00822:Otog	APN	7	46295880	missense	probably benign	0.24
IGL01354:Otog	APN	7	46289726	missense	probably damaging	1.00
IGL01567:Otog	APN	7	46276615	splice site	probably benign
IGL02034:Otog	APN	7	46295993	nonsense	probably null
IGL02090:Otog	APN	7	46300147	missense	probably damaging	1.00
IGL02132:Otog	APN	7	46305479	missense	probably damaging	0.99
IGL02148:Otog	APN	7	46300587	missense	probably damaging	1.00
IGL02173:Otog	APN	7	46276741	splice site	probably benign
IGL02199:Otog	APN	7	46277351	missense	possibly damaging	0.90
IGL02216:Otog	APN	7	46301468	missense	probably damaging	1.00
IGL02322:Otog	APN	7	46301457	missense	probably benign	0.01
IGL02330:Otog	APN	7	46288069	missense	possibly damaging	0.84
IGL02529:Otog	APN	7	46259957	missense	probably damaging	0.99
IGL02898:Otog	APN	7	46310138	missense	probably damaging	1.00
IGL02970:Otog	APN	7	46295867	missense	probably benign	0.11
IGL03085:Otog	APN	7	46305922	critical splice donor site	probably null
IGL03108:Otog	APN	7	46251338	missense	probably damaging	1.00
IGL03275:Otog	APN	7	46306230	missense	probably damaging	1.00
R0282_Otog_616	UTSW	7	46277493	missense	possibly damaging	0.93
R0636_otog_678	UTSW	7	46264228	critical splice donor site	probably null
R1029_otog_141	UTSW	7	46274595	missense	probably damaging	1.00
BB010:Otog	UTSW	7	46310147	missense	probably damaging	1.00
BB020:Otog	UTSW	7	46310147	missense	probably damaging	1.00
I1329:Otog	UTSW	7	46246503	missense	probably benign	0.02
IGL02984:Otog	UTSW	7	46305508	missense	probably damaging	0.98
PIT4472001:Otog	UTSW	7	46295849	missense	probably damaging	1.00
R0032:Otog	UTSW	7	46288213	nonsense	probably null
R0032:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0105:Otog	UTSW	7	46288366	missense	possibly damaging	0.79
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0165:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0166:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0167:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0282:Otog	UTSW	7	46277493	missense	possibly damaging	0.93
R0392:Otog	UTSW	7	46250075	missense	probably benign	0.00
R0436:Otog	UTSW	7	46265936	splice site	probably benign
R0441:Otog	UTSW	7	46305877	missense	probably damaging	1.00
R0499:Otog	UTSW	7	46273832	missense	probably damaging	1.00
R0530:Otog	UTSW	7	46298244	missense	probably damaging	0.98
R0541:Otog	UTSW	7	46269249	splice site	probably benign
R0600:Otog	UTSW	7	46251395	splice site	probably benign
R0626:Otog	UTSW	7	46271373	missense	possibly damaging	0.95
R0636:Otog	UTSW	7	46264228	critical splice donor site	probably null
R0764:Otog	UTSW	7	46300494	missense	probably benign	0.00
R0833:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0844:Otog	UTSW	7	46287828	missense	possibly damaging	0.53
R1029:Otog	UTSW	7	46274595	missense	probably damaging	1.00
R1116:Otog	UTSW	7	46300601	splice site	probably benign
R1134:Otog	UTSW	7	46298514	missense	probably damaging	1.00
R1183:Otog	UTSW	7	46289755	missense	probably benign	0.41
R1204:Otog	UTSW	7	46259911	missense	probably benign	0.16
R1301:Otog	UTSW	7	46289689	missense	probably damaging	1.00
R1344:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1384:Otog	UTSW	7	46273695	splice site	probably benign
R1418:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1432:Otog	UTSW	7	46300583	missense	probably damaging	1.00
R1479:Otog	UTSW	7	46295978	missense	possibly damaging	0.75
R1521:Otog	UTSW	7	46259264	missense	possibly damaging	0.71
R1589:Otog	UTSW	7	46283908	missense	probably benign	0.18
R1671:Otog	UTSW	7	46261786	missense	probably damaging	1.00
R1773:Otog	UTSW	7	46288159	missense	probably benign	0.28
R1806:Otog	UTSW	7	46290937	critical splice acceptor site	probably null
R1843:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1873:Otog	UTSW	7	46269343	missense	probably damaging	1.00
R1923:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1927:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R2008:Otog	UTSW	7	46264074	missense	probably benign	0.43
R2048:Otog	UTSW	7	46287639	missense	probably damaging	1.00
R2131:Otog	UTSW	7	46250100	missense	probably damaging	1.00
R2153:Otog	UTSW	7	46302904	missense	probably damaging	1.00
R2240:Otog	UTSW	7	46241029	start codon destroyed	probably null
R2278:Otog	UTSW	7	46300044	missense	probably damaging	1.00
R2407:Otog	UTSW	7	46241540	missense	probably benign	0.10
R2424:Otog	UTSW	7	46298169	nonsense	probably null
R2513:Otog	UTSW	7	46305590	critical splice donor site	probably null
R2863:Otog	UTSW	7	46269306	missense	probably damaging	1.00
R3148:Otog	UTSW	7	46290169	missense	probably damaging	1.00
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3733:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3734:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3855:Otog	UTSW	7	46273760	missense	possibly damaging	0.65
R3880:Otog	UTSW	7	46288021	missense	possibly damaging	0.93
R4081:Otog	UTSW	7	46288299	missense	possibly damaging	0.92
R4349:Otog	UTSW	7	46274189	missense	probably damaging	0.99
R4382:Otog	UTSW	7	46289698	missense	probably damaging	1.00
R4392:Otog	UTSW	7	46285124	missense	probably damaging	0.98
R4520:Otog	UTSW	7	46241053	unclassified	probably benign
R4569:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R4580:Otog	UTSW	7	46287801	missense	possibly damaging	0.78
R4672:Otog	UTSW	7	46289786	missense	probably damaging	0.98
R4764:Otog	UTSW	7	46288519	missense	probably benign	0.29
R4910:Otog	UTSW	7	46264062	missense	probably damaging	1.00
R4910:Otog	UTSW	7	46298534	missense	probably damaging	1.00
R4913:Otog	UTSW	7	46264102	missense	probably benign	0.31
R4975:Otog	UTSW	7	46287991	missense	probably benign	0.00
R4996:Otog	UTSW	7	46298606	missense	possibly damaging	0.51
R4996:Otog	UTSW	7	46305510	nonsense	probably null
R5116:Otog	UTSW	7	46273767	missense	probably benign	0.34
R5138:Otog	UTSW	7	46250006	missense	possibly damaging	0.61
R5169:Otog	UTSW	7	46298148	missense	probably benign	0.06
R5239:Otog	UTSW	7	46287435	missense	probably benign	0.15
R5277:Otog	UTSW	7	46246621	missense	possibly damaging	0.89
R5287:Otog	UTSW	7	46269329	missense	probably damaging	0.98
R5299:Otog	UTSW	7	46288851	missense	probably benign	0.16
R5378:Otog	UTSW	7	46255004	missense	probably damaging	1.00
R5382:Otog	UTSW	7	46249004	missense	probably damaging	1.00
R5487:Otog	UTSW	7	46288768	missense	probably benign	0.27
R5507:Otog	UTSW	7	46261699	missense	probably damaging	1.00
R5517:Otog	UTSW	7	46274571	missense	probably damaging	1.00
R5643:Otog	UTSW	7	46287447	missense	probably damaging	1.00
R5757:Otog	UTSW	7	46241121	critical splice donor site	probably null
R5910:Otog	UTSW	7	46298598	missense	possibly damaging	0.94
R6019:Otog	UTSW	7	46288950	missense	probably benign	0.00
R6150:Otog	UTSW	7	46264059	missense	possibly damaging	0.82
R6225:Otog	UTSW	7	46249034	missense	possibly damaging	0.67
R6271:Otog	UTSW	7	46252040	missense	probably damaging	1.00
R6317:Otog	UTSW	7	46301215	missense	probably damaging	1.00
R6454:Otog	UTSW	7	46305817	missense	probably damaging	1.00
R6640:Otog	UTSW	7	46261743	missense	possibly damaging	0.92
R6753:Otog	UTSW	7	46249071	missense	probably benign	0.06
R6788:Otog	UTSW	7	46298317	missense	probably damaging	1.00
R6859:Otog	UTSW	7	46273781	missense	probably damaging	0.96
R7033:Otog	UTSW	7	46267398	critical splice donor site	probably null
R7071:Otog	UTSW	7	46267323	missense	probably damaging	1.00
R7084:Otog	UTSW	7	46298566	nonsense	probably null
R7116:Otog	UTSW	7	46298265	missense	probably damaging	0.99
R7202:Otog	UTSW	7	46288050	missense	probably damaging	0.97
R7365:Otog	UTSW	7	46298308	missense	probably damaging	1.00
R7468:Otog	UTSW	7	46264119	missense	probably benign
R7475:Otog	UTSW	7	46267276	missense	probably damaging	0.99
R7502:Otog	UTSW	7	46298615	missense	probably damaging	1.00
R7558:Otog	UTSW	7	46303160	missense	probably damaging	0.99
R7577:Otog	UTSW	7	46287855	missense	possibly damaging	0.62
R7651:Otog	UTSW	7	46241761	missense	probably benign	0.00
R7689:Otog	UTSW	7	46252056	missense	probably damaging	1.00
R7806:Otog	UTSW	7	46285776	missense	probably benign
R7933:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R8021:Otog	UTSW	7	46267342	missense	probably damaging	0.98
R8082:Otog	UTSW	7	46289719	missense	probably damaging	1.00
R8531:Otog	UTSW	7	46252049	missense	probably damaging	0.99
R8772:Otog	UTSW	7	46284928	missense	probably damaging	1.00
R8816:Otog	UTSW	7	46301481	missense	possibly damaging	0.92
R8842:Otog	UTSW	7	46246524	missense	probably damaging	1.00
R8987:Otog	UTSW	7	46287454	missense	probably benign	0.43
R8988:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R9010:Otog	UTSW	7	46300470	missense	probably benign	0.00
R9025:Otog	UTSW	7	46288096	missense	probably benign	0.13
R9131:Otog	UTSW	7	46303173	nonsense	probably null
R9179:Otog	UTSW	7	46288461	missense	possibly damaging	0.65
R9334:Otog	UTSW	7	46259929	missense	possibly damaging	0.95
R9365:Otog	UTSW	7	46271264	missense	probably damaging	1.00
R9408:Otog	UTSW	7	46267297	missense	possibly damaging	0.79
R9418:Otog	UTSW	7	46288600	missense	probably benign	0.41
R9465:Otog	UTSW	7	46305875	missense	possibly damaging	0.80
R9496:Otog	UTSW	7	46241081	missense	unknown
R9632:Otog	UTSW	7	46265719	missense	probably benign	0.27
R9656:Otog	UTSW	7	46310143	missense	probably damaging	1.00
RF024:Otog	UTSW	7	46287669	missense	probably damaging	1.00
X0062:Otog	UTSW	7	46259921	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46262852	missense	possibly damaging	0.80
Z1177:Otog	UTSW	7	46274538	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46289740	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46309985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGGACCCTGGGCTATTATAGGGA -3'
(R):5'- CCCCAGCCTGTCACCATTGAAA -3'

Sequencing Primer
(F):5'- caccctgaccaaaagcaac -3'
(R):5'- AATTCAACTCTCTGGCACCTG -3'

Posted On

2013-10-16