Incidental Mutation 'R0837:Hist2h2ab'
ID77980
Institutional Source Beutler Lab
Gene Symbol Hist2h2ab
Ensembl Gene ENSMUSG00000063689
Gene Namehistone cluster 2, H2ab
SynonymsH2a-613a, EG621893
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96219865-96220308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96220123 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 70 (A70T)
Ref Sequence ENSEMBL: ENSMUSP00000072858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073115] [ENSMUST00000090781] [ENSMUST00000090782] [ENSMUST00000177442]
Predicted Effect probably damaging
Transcript: ENSMUST00000073115
AA Change: A70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072858
Gene: ENSMUSG00000063689
AA Change: A70T

DomainStartEndE-ValueType
H2A 3 123 8.91e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090781
SMART Domains Protein: ENSMUSP00000088287
Gene: ENSMUSG00000068854

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
H2B 28 124 1.14e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090782
SMART Domains Protein: ENSMUSP00000088288
Gene: ENSMUSG00000068855

DomainStartEndE-ValueType
H2A 3 123 1.1e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148335
Predicted Effect probably benign
Transcript: ENSMUST00000177442
SMART Domains Protein: ENSMUSP00000134765
Gene: ENSMUSG00000015943

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:BolA 40 113 7.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197012
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Hist2h2ab
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2229:Hist2h2ab UTSW 3 96220106 missense possibly damaging 0.84
R5578:Hist2h2ab UTSW 3 96220238 missense probably damaging 1.00
R5635:Hist2h2ab UTSW 3 96220277 missense possibly damaging 0.52
R7034:Hist2h2ab UTSW 3 96219988 nonsense probably null
Z1176:Hist2h2ab UTSW 3 96220051 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCAGCAGAAATTGCTTATTCCGCC -3'
(R):5'- TTGTGACCAGCCCTTTGGATGAC -3'

Sequencing Primer
(F):5'- AGAAATTGCTTATTCCGCCATGTC -3'
(R):5'- AGCCCTTTGGATGACACTTTG -3'
Posted On2013-10-16