Incidental Mutation 'R0837:H2ac21'
ID 77980
Institutional Source Beutler Lab
Gene Symbol H2ac21
Ensembl Gene ENSMUSG00000063689
Gene Name H2A clustered histone 21
Synonyms EG621893, Hist2h2ab, H2a-613a
MMRRC Submission 039016-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.420) question?
Stock # R0837 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 96127201-96127634 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 96127439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 70 (A70T)
Ref Sequence ENSEMBL: ENSMUSP00000072858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073115] [ENSMUST00000090781] [ENSMUST00000090782] [ENSMUST00000177442]
AlphaFold Q64522
Predicted Effect probably damaging
Transcript: ENSMUST00000073115
AA Change: A70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072858
Gene: ENSMUSG00000063689
AA Change: A70T

DomainStartEndE-ValueType
H2A 3 123 8.91e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090781
SMART Domains Protein: ENSMUSP00000088287
Gene: ENSMUSG00000068854

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
H2B 28 124 1.14e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090782
SMART Domains Protein: ENSMUSP00000088288
Gene: ENSMUSG00000068855

DomainStartEndE-ValueType
H2A 3 123 1.1e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148335
Predicted Effect probably benign
Transcript: ENSMUST00000177442
SMART Domains Protein: ENSMUSP00000134765
Gene: ENSMUSG00000015943

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:BolA 40 113 7.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197012
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,333,375 (GRCm39) probably benign Het
4930579C12Rik A G 9: 89,050,260 (GRCm39) noncoding transcript Het
Adam34 T A 8: 44,104,537 (GRCm39) K369N probably benign Het
Ap1g1 T C 8: 110,577,697 (GRCm39) W481R probably damaging Het
Bicdl1 G A 5: 115,869,351 (GRCm39) P26S probably benign Het
Cacna1c A T 6: 118,607,231 (GRCm39) C1224* probably null Het
Cpsf2 C T 12: 101,963,501 (GRCm39) probably benign Het
Cyp11b2 G A 15: 74,725,490 (GRCm39) R210W probably damaging Het
Dock7 C T 4: 98,877,495 (GRCm39) V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 (GRCm39) A2908S probably benign Het
Elane A G 10: 79,722,942 (GRCm39) D116G probably damaging Het
Epb41l2 C T 10: 25,383,714 (GRCm39) R153C probably damaging Het
Gucy2c G A 6: 136,699,418 (GRCm39) P617L probably damaging Het
Kcnq4 T A 4: 120,604,058 (GRCm39) I106L probably benign Het
Man2b1 A G 8: 85,823,458 (GRCm39) N931D possibly damaging Het
Mthfs A G 9: 89,097,443 (GRCm39) E100G probably damaging Het
Mto1 A T 9: 78,381,072 (GRCm39) I639F probably damaging Het
Myo15a A G 11: 60,378,077 (GRCm39) E177G probably damaging Het
Naip5 T A 13: 100,367,251 (GRCm39) M282L probably benign Het
Or10aa1 A G 1: 173,870,053 (GRCm39) D179G probably damaging Het
Pik3c2g G A 6: 139,903,425 (GRCm39) probably benign Het
Prl7d1 T A 13: 27,898,321 (GRCm39) M64L probably benign Het
Prnp A T 2: 131,778,444 (GRCm39) N32I probably damaging Het
Ptpn11 C T 5: 121,287,174 (GRCm39) V406I probably benign Het
Rab40c G A 17: 26,103,667 (GRCm39) T151I probably damaging Het
Rb1cc1 T A 1: 6,304,495 (GRCm39) probably null Het
Rnf145 T C 11: 44,415,815 (GRCm39) V10A probably benign Het
Rtn4rl2 T C 2: 84,711,036 (GRCm39) N70S probably damaging Het
Scaper A T 9: 55,766,326 (GRCm39) C483* probably null Het
Sema4a T A 3: 88,360,405 (GRCm39) Q58L possibly damaging Het
Slf1 T C 13: 77,249,067 (GRCm39) probably null Het
Sycp1 G T 3: 102,822,561 (GRCm39) N364K probably benign Het
Tenm4 T C 7: 96,545,482 (GRCm39) probably benign Het
Tnfaip2 A G 12: 111,417,141 (GRCm39) T537A probably damaging Het
Trappc12 A G 12: 28,753,596 (GRCm39) I573T possibly damaging Het
Ugt2b38 G A 5: 87,559,632 (GRCm39) T420I probably damaging Het
Ulk1 A T 5: 110,937,411 (GRCm39) probably benign Het
Unc80 G A 1: 66,688,103 (GRCm39) C2367Y possibly damaging Het
Usp7 C A 16: 8,521,366 (GRCm39) G135C probably damaging Het
Vmn2r103 A G 17: 20,014,189 (GRCm39) Y327C probably damaging Het
Vmn2r28 T A 7: 5,491,026 (GRCm39) H407L probably damaging Het
Zfp804a A C 2: 82,089,506 (GRCm39) T1112P probably damaging Het
Zfr2 A G 10: 81,081,242 (GRCm39) K431E probably damaging Het
Zfy1 A T Y: 725,850 (GRCm39) Y638* probably null Het
Other mutations in H2ac21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2229:H2ac21 UTSW 3 96,127,422 (GRCm39) missense possibly damaging 0.84
R5578:H2ac21 UTSW 3 96,127,554 (GRCm39) missense probably damaging 1.00
R5635:H2ac21 UTSW 3 96,127,593 (GRCm39) missense possibly damaging 0.52
R7034:H2ac21 UTSW 3 96,127,304 (GRCm39) nonsense probably null
R9495:H2ac21 UTSW 3 96,127,401 (GRCm39) missense probably damaging 1.00
R9514:H2ac21 UTSW 3 96,127,401 (GRCm39) missense probably damaging 1.00
Z1176:H2ac21 UTSW 3 96,127,367 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCAGCAGAAATTGCTTATTCCGCC -3'
(R):5'- TTGTGACCAGCCCTTTGGATGAC -3'

Sequencing Primer
(F):5'- AGAAATTGCTTATTCCGCCATGTC -3'
(R):5'- AGCCCTTTGGATGACACTTTG -3'
Posted On 2013-10-16