Incidental Mutation 'R0837:Cpsf2'
ID78008
Institutional Source Beutler Lab
Gene Symbol Cpsf2
Ensembl Gene ENSMUSG00000041781
Gene Namecleavage and polyadenylation specific factor 2
Synonyms100kDa, 2610024B04Rik, Cpsf
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0837 (G1)
Quality Score219
Status Validated
Chromosome12
Chromosomal Location101975988-102006424 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 101997242 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047357]
Predicted Effect probably benign
Transcript: ENSMUST00000047357
SMART Domains Protein: ENSMUSP00000047797
Gene: ENSMUSG00000041781

DomainStartEndE-ValueType
Lactamase_B 17 223 5.22e-1 SMART
Beta-Casp 243 368 1.8e-21 SMART
coiled coil region 380 418 N/A INTRINSIC
Pfam:RMMBL 527 569 1.2e-14 PFAM
Pfam:CPSF100_C 608 779 5.7e-46 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Cpsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cpsf2 APN 12 101983466 missense probably damaging 1.00
IGL01114:Cpsf2 APN 12 101989839 missense possibly damaging 0.93
IGL01121:Cpsf2 APN 12 101988706 missense probably damaging 1.00
IGL01377:Cpsf2 APN 12 101987381 splice site probably null
IGL01465:Cpsf2 APN 12 101997333 missense probably damaging 1.00
IGL02861:Cpsf2 APN 12 101999566 missense probably benign 0.00
R0469:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0504:Cpsf2 UTSW 12 101990003 missense probably damaging 1.00
R0510:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0626:Cpsf2 UTSW 12 101985231 missense probably benign 0.09
R0697:Cpsf2 UTSW 12 101983184 missense probably benign 0.34
R1475:Cpsf2 UTSW 12 101985236 missense probably damaging 1.00
R1709:Cpsf2 UTSW 12 101999542 missense probably damaging 1.00
R1974:Cpsf2 UTSW 12 101990047 missense probably benign 0.33
R1996:Cpsf2 UTSW 12 101998608 missense probably benign 0.18
R2063:Cpsf2 UTSW 12 101983463 missense probably damaging 1.00
R2164:Cpsf2 UTSW 12 101985335 missense probably damaging 1.00
R2228:Cpsf2 UTSW 12 101989829 missense probably benign 0.00
R3082:Cpsf2 UTSW 12 101988810 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3733:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R4627:Cpsf2 UTSW 12 101989895 missense probably benign 0.18
R4665:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4666:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4765:Cpsf2 UTSW 12 101997440 missense probably damaging 1.00
R4777:Cpsf2 UTSW 12 101996832 missense probably damaging 0.99
R4847:Cpsf2 UTSW 12 101997302 missense probably benign 0.18
R4923:Cpsf2 UTSW 12 101981984 missense probably benign
R4975:Cpsf2 UTSW 12 101983493 missense probably damaging 1.00
R5239:Cpsf2 UTSW 12 101987273 nonsense probably null
R5440:Cpsf2 UTSW 12 101996879 missense probably benign
R5601:Cpsf2 UTSW 12 101985355 splice site probably null
R5603:Cpsf2 UTSW 12 101998631 missense probably benign 0.02
R5841:Cpsf2 UTSW 12 101985238 missense probably damaging 0.99
R6153:Cpsf2 UTSW 12 101999360 splice site probably null
R6663:Cpsf2 UTSW 12 101999593 missense probably damaging 1.00
R7451:Cpsf2 UTSW 12 102000792 missense possibly damaging 0.52
V8831:Cpsf2 UTSW 12 102003141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGCGCTTGTAGGACTTAGCAC -3'
(R):5'- GGAAACATGGGGTAGGACTTCTTGG -3'

Sequencing Primer
(F):5'- TTGTAGGACTTAGCACTCAACGG -3'
(R):5'- GCCTGTTTGAAGAAGCTCCC -3'
Posted On2013-10-16