Incidental Mutation 'R1350:Car9'
ID 159516
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Name carbonic anhydrase 9
Synonyms CAIX, MN/CA9
MMRRC Submission 039415-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1350 (G1)
Quality Score 216
Status Validated
Chromosome 4
Chromosomal Location 43507026-43513729 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 43512439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
AlphaFold Q8VHB5
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,400,925 (GRCm39) V640A probably benign Het
AI661453 C T 17: 47,778,853 (GRCm39) Q860* probably null Het
Atp10d A G 5: 72,418,469 (GRCm39) probably benign Het
Axdnd1 A G 1: 156,205,950 (GRCm39) probably null Het
Bivm T A 1: 44,165,863 (GRCm39) N104K possibly damaging Het
Capn15 A G 17: 26,183,666 (GRCm39) S338P probably benign Het
Ccn6 C T 10: 39,034,302 (GRCm39) C100Y probably damaging Het
Col13a1 G A 10: 61,729,848 (GRCm39) probably benign Het
Crb2 A G 2: 37,682,081 (GRCm39) N821D probably damaging Het
D5Ertd579e T A 5: 36,771,081 (GRCm39) I1105F probably damaging Het
Dnaja2 A T 8: 86,266,717 (GRCm39) F337I probably damaging Het
Dntt C T 19: 41,025,578 (GRCm39) probably benign Het
Dock3 C T 9: 106,791,831 (GRCm39) E1381K possibly damaging Het
Fibp T C 19: 5,511,419 (GRCm39) Y96H probably damaging Het
Garnl3 A G 2: 32,942,226 (GRCm39) V85A probably damaging Het
Gsdme A T 6: 50,223,108 (GRCm39) probably null Het
Gucy2c A T 6: 136,720,912 (GRCm39) probably null Het
Hectd1 A G 12: 51,809,217 (GRCm39) V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 (GRCm39) Q384* probably null Het
Itga10 T A 3: 96,564,793 (GRCm39) M961K probably benign Het
Kcnk1 C T 8: 126,751,967 (GRCm39) T191I probably benign Het
Khdrbs1 G A 4: 129,614,545 (GRCm39) P336L probably benign Het
Klhdc2 T A 12: 69,352,484 (GRCm39) probably null Het
Lipc T C 9: 70,705,649 (GRCm39) H478R probably benign Het
Lrp12 A T 15: 39,741,646 (GRCm39) C356* probably null Het
Nf1 T A 11: 79,303,513 (GRCm39) C397S probably damaging Het
Nox3 A G 17: 3,700,396 (GRCm39) F439S probably damaging Het
Or12e9 T A 2: 87,202,701 (GRCm39) V275E probably benign Het
Or13a18 T C 7: 140,190,622 (GRCm39) V181A probably damaging Het
Or3a1b T C 11: 74,013,039 (GRCm39) L308P possibly damaging Het
Or4b12 A T 2: 90,096,690 (GRCm39) L28Q probably damaging Het
Or51b17 A G 7: 103,542,937 (GRCm39) W2R probably benign Het
Or7g29 T G 9: 19,286,710 (GRCm39) S156R possibly damaging Het
Or8b37 G A 9: 37,959,111 (GRCm39) V198I probably benign Het
Pcif1 T C 2: 164,728,687 (GRCm39) F288L probably damaging Het
Prxl2b C A 4: 154,982,585 (GRCm39) R107L probably damaging Het
Skint7 G T 4: 111,837,521 (GRCm39) A100S possibly damaging Het
Ssu2 A T 6: 112,351,807 (GRCm39) L306* probably null Het
Tasp1 T C 2: 139,899,341 (GRCm39) E4G probably damaging Het
Tfb1m A T 17: 3,595,955 (GRCm39) D99E probably benign Het
Ube3b A G 5: 114,544,198 (GRCm39) probably null Het
Uox A G 3: 146,330,330 (GRCm39) D162G probably damaging Het
Usp18 A G 6: 121,239,651 (GRCm39) T249A possibly damaging Het
Vmn1r202 T C 13: 22,685,886 (GRCm39) N177S probably benign Het
Vwa2 T A 19: 56,897,558 (GRCm39) M621K probably damaging Het
Wdfy3 C A 5: 102,046,418 (GRCm39) D1797Y probably damaging Het
Ylpm1 A T 12: 85,060,856 (GRCm39) probably benign Het
Zbtb9 G A 17: 27,193,380 (GRCm39) V262I probably benign Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43,512,941 (GRCm39) splice site probably benign
IGL01893:Car9 APN 4 43,510,252 (GRCm39) missense probably damaging 1.00
IGL02064:Car9 APN 4 43,507,363 (GRCm39) missense probably benign
R0122:Car9 UTSW 4 43,512,206 (GRCm39) missense probably benign 0.05
R0314:Car9 UTSW 4 43,509,212 (GRCm39) critical splice donor site probably null
R0497:Car9 UTSW 4 43,511,881 (GRCm39) missense probably damaging 1.00
R1018:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1132:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1218:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1219:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1222:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1351:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1352:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1353:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1389:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1417:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1573:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1818:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1819:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R4033:Car9 UTSW 4 43,508,624 (GRCm39) missense possibly damaging 0.52
R4597:Car9 UTSW 4 43,509,138 (GRCm39) missense probably damaging 1.00
R4609:Car9 UTSW 4 43,507,267 (GRCm39) missense possibly damaging 0.81
R4719:Car9 UTSW 4 43,508,616 (GRCm39) nonsense probably null
R5402:Car9 UTSW 4 43,510,213 (GRCm39) missense probably damaging 1.00
R5624:Car9 UTSW 4 43,509,146 (GRCm39) missense probably benign 0.03
R6471:Car9 UTSW 4 43,511,938 (GRCm39) missense probably damaging 1.00
R6850:Car9 UTSW 4 43,507,321 (GRCm39) missense probably damaging 0.96
R7318:Car9 UTSW 4 43,513,089 (GRCm39) missense probably damaging 0.99
R7680:Car9 UTSW 4 43,507,250 (GRCm39) missense probably damaging 0.96
R8378:Car9 UTSW 4 43,509,021 (GRCm39) missense probably damaging 1.00
R9313:Car9 UTSW 4 43,507,180 (GRCm39) missense probably benign 0.03
X0067:Car9 UTSW 4 43,507,198 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGTGATTCTCGGCTACAACTGAAC -3'
(R):5'- CTTCCAGCAGCTAGGTGAAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTTGAATGGGCGAAC -3'
(R):5'- AGATTTCTGGAGCCTCATTCAGAC -3'
Posted On 2014-03-14