Incidental Mutation 'R1396:Zhx3'
ID162629
Institutional Source Beutler Lab
Gene Symbol Zhx3
Ensembl Gene ENSMUSG00000035877
Gene Namezinc fingers and homeoboxes 3
Synonyms9530010N21Rik, 4932418O04Rik, Tix1, 1810059C13Rik
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160748708-160872998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 160781020 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 409 (H409L)
Ref Sequence ENSEMBL: ENSMUSP00000105086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000109460] [ENSMUST00000127201] [ENSMUST00000176141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103111
AA Change: H409L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877
AA Change: H409L

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103112
AA Change: H409L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877
AA Change: H409L

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109460
AA Change: H409L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105086
Gene: ENSMUSG00000035877
AA Change: H409L

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 841 888 1.3e-17 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127201
SMART Domains Protein: ENSMUSP00000120488
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect probably benign
Transcript: ENSMUST00000176141
SMART Domains Protein: ENSMUSP00000134763
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Other mutations in Zhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zhx3 APN 2 160780841 missense probably damaging 0.99
IGL01759:Zhx3 APN 2 160780714 missense probably damaging 1.00
IGL02170:Zhx3 APN 2 160779798 missense probably damaging 1.00
IGL02550:Zhx3 APN 2 160781296 missense probably damaging 1.00
R0497:Zhx3 UTSW 2 160779994 nonsense probably null
R0882:Zhx3 UTSW 2 160780709 missense probably damaging 1.00
R1587:Zhx3 UTSW 2 160781693 unclassified probably null
R1646:Zhx3 UTSW 2 160781275 missense probably damaging 1.00
R1822:Zhx3 UTSW 2 160780355 missense probably benign 0.03
R2322:Zhx3 UTSW 2 160782028 missense probably damaging 1.00
R3791:Zhx3 UTSW 2 160780448 missense possibly damaging 0.94
R3899:Zhx3 UTSW 2 160780451 missense possibly damaging 0.82
R4003:Zhx3 UTSW 2 160780889 missense probably damaging 0.96
R4619:Zhx3 UTSW 2 160781959 missense probably damaging 0.96
R5307:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R5461:Zhx3 UTSW 2 160780018 missense probably benign
R5648:Zhx3 UTSW 2 160781961 missense probably damaging 1.00
R5952:Zhx3 UTSW 2 160782017 missense probably damaging 1.00
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6734:Zhx3 UTSW 2 160781720 missense probably damaging 0.99
R6988:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R7032:Zhx3 UTSW 2 160780978 missense probably damaging 1.00
R7288:Zhx3 UTSW 2 160781122 missense probably damaging 1.00
R7348:Zhx3 UTSW 2 160782118 nonsense probably null
R8101:Zhx3 UTSW 2 160781699 missense probably damaging 0.99
R8152:Zhx3 UTSW 2 160780775 missense probably benign
RF002:Zhx3 UTSW 2 160781806 missense probably damaging 0.98
Z1088:Zhx3 UTSW 2 160779755 unclassified probably benign
Z1176:Zhx3 UTSW 2 160781060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGTGTTAATGGGTGCCACAG -3'
(R):5'- GCAGCTATGGACTCCAACAGCTTTC -3'

Sequencing Primer
(F):5'- CCACAGTTGGCTTGGGAAC -3'
(R):5'- ACTGTGGTGACCAAGTATCC -3'
Posted On2014-03-17