Mutagenetix > Incidental Mutations

Incidental Mutation 'R1396:Ptpro'

162641

Institutional Source

Beutler Lab

Gene Symbol

Ptpro

Ensembl Gene

ENSMUSG00000030223

Gene Name

protein tyrosine phosphatase, receptor type, O

Synonyms

Ptpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt

MMRRC Submission

039458-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1396 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

137252319-137463233 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 137443594 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1007 (V1007D)

Ref Sequence

ENSEMBL: ENSMUSP00000127112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077115
AA Change: V1035D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V1035D

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
transmembrane domain	890	912	N/A	INTRINSIC
PTPc	947	1207	1.43e-127	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167002
AA Change: V214D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: V214D

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	69	91	N/A	INTRINSIC
PTPc	126	386	1.43e-127	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167679
AA Change: V1007D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V1007D

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
PTPc	919	1179	1.43e-127	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000203914
AA Change: V186D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: V186D

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
PTPc	98	358	6.1e-130	SMART

Meta Mutation Damage Score

0.9197

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	A	G	14: 95,882,551	N248S	probably benign	Het
4930486L24Rik	G	A	13: 60,853,243	P160S	probably benign	Het
Adamts12	G	T	15: 11,311,472	D1272Y	probably benign	Het
Akr1c20	A	T	13: 4,507,727	V267D	probably damaging	Het
C1s1	A	G	6: 124,531,051	S660P	probably damaging	Het
Ccdc40	A	G	11: 119,231,803	T144A	possibly damaging	Het
Cdk20	T	C	13: 64,437,403	I167T	probably damaging	Het
Chd6	A	G	2: 160,983,103	L1212S	probably damaging	Het
Clock	G	C	5: 76,266,802	D15E	probably benign	Het
Clstn2	A	G	9: 97,461,393	V667A	probably benign	Het
Cr2	A	T	1: 195,169,253		probably null	Het
Cyp2e1	A	G	7: 140,773,079	D343G	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Etf1	G	A	18: 34,908,167	T298I	possibly damaging	Het
Gm5431	T	C	11: 48,895,434		probably benign	Het
Gss	G	A	2: 155,567,721	T265I	probably damaging	Het
Heatr1	C	T	13: 12,406,046	S406L	possibly damaging	Het
Hgsnat	C	A	8: 25,957,335	M310I	possibly damaging	Het
Inpp5b	G	A	4: 124,789,080	R598H	probably damaging	Het
Ints2	G	T	11: 86,249,248	Q253K	probably damaging	Het
Kng1	A	G	16: 23,078,980	M377V	probably benign	Het
Krt72	C	T	15: 101,786,005		probably null	Het
Lemd2	G	C	17: 27,190,732	R482G	probably damaging	Het
Lrpprc	C	T	17: 84,726,303	D1049N	possibly damaging	Het
Lrrc49	A	T	9: 60,680,527	H117Q	probably damaging	Het
Mcm6	A	T	1: 128,351,476	F191Y	probably damaging	Het
Mecom	T	C	3: 29,979,800	T252A	possibly damaging	Het
Mgat4e	T	C	1: 134,541,533	T258A	probably benign	Het
Mpeg1	A	G	19: 12,462,804	N542S	probably damaging	Het
Nln	C	T	13: 104,061,753	V184I	probably benign	Het
Nova1	A	C	12: 46,816,893	F91L	unknown	Het
Polk	T	C	13: 96,484,208	I516V	probably benign	Het
Ppig	C	T	2: 69,749,018	P357S	unknown	Het
Rasal2	A	T	1: 157,164,666	H552Q	probably damaging	Het
Rnf41	G	A	10: 128,435,571	E117K	probably benign	Het
Sbk3	A	G	7: 4,967,453	Y306H	possibly damaging	Het
Senp1	A	G	15: 98,076,554	S126P	probably benign	Het
Sfr1	A	G	19: 47,733,690	K182E	probably benign	Het
Slc25a4	C	A	8: 46,209,288	R111L	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Stard4	A	T	18: 33,206,210	N80K	probably damaging	Het
Tbk1	G	A	10: 121,571,916	T104M	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tmem102	A	T	11: 69,804,370	W259R	probably damaging	Het
Tnk1	A	T	11: 69,853,136	C466S	probably benign	Het
Tspoap1	A	C	11: 87,766,120	Q307P	probably damaging	Het
Ugt2b35	A	G	5: 87,011,530	N528D	possibly damaging	Het
Usp6nl	A	G	2: 6,426,998		probably null	Het
Vmn1r203	C	T	13: 22,524,508	T153M	probably benign	Het
Vmn1r89	T	A	7: 13,220,011	S157T	probably damaging	Het
Vmn2r103	A	T	17: 19,792,968	Y117F	probably benign	Het
Vmn2r116	A	C	17: 23,386,141	M143L	probably benign	Het
Vmn2r62	A	T	7: 42,764,837	D727E	probably damaging	Het
Vps13c	A	G	9: 67,955,022	I2974V	probably benign	Het
Wrn	C	T	8: 33,268,819	G769D	probably damaging	Het
Zhx3	T	A	2: 160,781,020	H409L	possibly damaging	Het

Other mutations in Ptpro

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ptpro	APN	6	137394909	critical splice donor site	probably null
IGL00844:Ptpro	APN	6	137414239	missense	probably damaging	1.00
IGL00983:Ptpro	APN	6	137418248	missense	probably benign	0.01
IGL01073:Ptpro	APN	6	137377088	missense	probably damaging	1.00
IGL01832:Ptpro	APN	6	137393668	missense	possibly damaging	0.93
IGL02308:Ptpro	APN	6	137454700	missense	probably benign	0.37
IGL02387:Ptpro	APN	6	137410980	missense	probably damaging	0.96
IGL02605:Ptpro	APN	6	137380318	missense	probably benign	0.02
IGL02666:Ptpro	APN	6	137378059	missense	probably damaging	0.96
IGL03275:Ptpro	APN	6	137450006	missense	probably damaging	1.00
Brau	UTSW	6	137454598	missense	probably damaging	1.00
court	UTSW	6	137393675	nonsense	probably null
Jester	UTSW	6	137449917	missense	probably damaging	1.00
mann	UTSW	6	137411116	splice site	probably null
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0020:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0022:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0023:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0024:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0094:Ptpro	UTSW	6	137386352	missense	probably benign	0.08
R0094:Ptpro	UTSW	6	137386352	missense	probably benign	0.08
R0103:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0106:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0316:Ptpro	UTSW	6	137376989	missense	possibly damaging	0.81
R0427:Ptpro	UTSW	6	137368296	missense	possibly damaging	0.81
R0456:Ptpro	UTSW	6	137414230	missense	probably benign	0.04
R0536:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0537:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0552:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0555:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0664:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0708:Ptpro	UTSW	6	137386253	missense	probably benign	0.26
R0730:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0735:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0738:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0786:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0811:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0812:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0881:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0973:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1259:Ptpro	UTSW	6	137392741	missense	probably damaging	0.98
R1340:Ptpro	UTSW	6	137441081	missense	possibly damaging	0.95
R1381:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1382:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1385:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1401:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1416:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1422:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1448:Ptpro	UTSW	6	137441116	missense	probably damaging	1.00
R1513:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1518:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1526:Ptpro	UTSW	6	137461726	missense	probably damaging	1.00
R1540:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1571:Ptpro	UTSW	6	137378130	missense	probably benign
R1573:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1587:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1588:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1649:Ptpro	UTSW	6	137444017	nonsense	probably null
R1700:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1701:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1745:Ptpro	UTSW	6	137400645	missense	probably benign	0.03
R1772:Ptpro	UTSW	6	137430743	missense	probably damaging	1.00
R1911:Ptpro	UTSW	6	137400619	splice site	probably benign
R1958:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1967:Ptpro	UTSW	6	137416865	missense	probably benign	0.38
R2025:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2026:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2040:Ptpro	UTSW	6	137386164	splice site	probably benign
R2115:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2117:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2130:Ptpro	UTSW	6	137411116	splice site	probably null
R2161:Ptpro	UTSW	6	137449887	missense	probably benign	0.01
R2431:Ptpro	UTSW	6	137443585	nonsense	probably null
R2915:Ptpro	UTSW	6	137414241	start gained	probably benign
R2988:Ptpro	UTSW	6	137443599	nonsense	probably null
R3772:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3773:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3795:Ptpro	UTSW	6	137380309	missense	probably benign
R3885:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3886:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3887:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3888:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3893:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4032:Ptpro	UTSW	6	137461742	missense	probably damaging	1.00
R4133:Ptpro	UTSW	6	137420372	missense	probably damaging	1.00
R4377:Ptpro	UTSW	6	137380266	missense	probably benign	0.26
R4455:Ptpro	UTSW	6	137393659	missense	probably damaging	1.00
R4613:Ptpro	UTSW	6	137416836	nonsense	probably null
R4827:Ptpro	UTSW	6	137442710	missense	probably damaging	1.00
R4863:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4870:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R4910:Ptpro	UTSW	6	137368338	missense	probably damaging	0.99
R4932:Ptpro	UTSW	6	137411105	nonsense	probably null
R4941:Ptpro	UTSW	6	137392765	missense	probably damaging	1.00
R4989:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5009:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R5032:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5033:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5162:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5393:Ptpro	UTSW	6	137380224	missense	probably benign	0.04
R5423:Ptpro	UTSW	6	137442707	missense	probably damaging	1.00
R5782:Ptpro	UTSW	6	137399498	missense	possibly damaging	0.80
R6103:Ptpro	UTSW	6	137400706	missense	possibly damaging	0.76
R6239:Ptpro	UTSW	6	137380608	missense	probably benign	0.28
R6488:Ptpro	UTSW	6	137393675	nonsense	probably null
R6494:Ptpro	UTSW	6	137382642	missense	probably benign	0.20
R6746:Ptpro	UTSW	6	137394823	missense	probably damaging	1.00
R6763:Ptpro	UTSW	6	137418281	splice site	probably null
R6888:Ptpro	UTSW	6	137380200	missense	probably benign	0.30
R6983:Ptpro	UTSW	6	137449917	missense	probably damaging	1.00
R7019:Ptpro	UTSW	6	137380478	missense	probably benign
R7218:Ptpro	UTSW	6	137454598	missense	probably damaging	1.00
R7236:Ptpro	UTSW	6	137368337	missense	probably damaging	1.00
R7299:Ptpro	UTSW	6	137441144	critical splice donor site	probably null
R7381:Ptpro	UTSW	6	137399561	missense	possibly damaging	0.93
R7493:Ptpro	UTSW	6	137382649	missense	probably benign	0.01
R7733:Ptpro	UTSW	6	137414286	nonsense	probably null
R7793:Ptpro	UTSW	6	137416820	missense	probably damaging	0.99
R7833:Ptpro	UTSW	6	137416863	nonsense	probably null
R7859:Ptpro	UTSW	6	137392807	critical splice donor site	probably null
R7873:Ptpro	UTSW	6	137430739	missense	probably benign	0.44
R7916:Ptpro	UTSW	6	137416863	nonsense	probably null
R7942:Ptpro	UTSW	6	137392807	critical splice donor site	probably null
R7956:Ptpro	UTSW	6	137430739	missense	probably benign	0.44
R8042:Ptpro	UTSW	6	137416883	missense	not run
Z1177:Ptpro	UTSW	6	137378140	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGTGTGTGATCCTCTGCCAACTTC -3'
(R):5'- CCTTTCAAAAGAATGATGCAGCCCC -3'

Sequencing Primer
(F):5'- TTCGTCATCAGCAAAAACGGC -3'
(R):5'- TGATGCAGCCCCATGAAG -3'

Posted On

2014-03-17