Mutagenetix > Incidental Mutation

Incidental Mutation 'R1565:Plekhg1'

175204

Institutional Source

Beutler Lab

Gene Symbol

Plekhg1

Ensembl Gene

ENSMUSG00000040624

Gene Name

pleckstrin homology domain containing, family G (with RhoGef domain) member 1

Synonyms

D10Ertd733e

MMRRC Submission

039604-MU

Accession Numbers

Ncbi RefSeq: NM_001159942.1, NM_001033253.3; MGI:2676551

Essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R1565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3740364-3967303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3940526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 394 (T394I)

Ref Sequence

ENSEMBL: ENSMUSP00000114056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042438] [ENSMUST00000120274]

AlphaFold

A0A5F8MPP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000042438
AA Change: T394I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040495
Gene: ENSMUSG00000040624
AA Change: T394I

Domain	Start	End	E-Value	Type
low complexity region	11	30	N/A	INTRINSIC
RhoGEF	116	291	4.17e-52	SMART
PH	323	417	2.54e-6	SMART
low complexity region	419	431	N/A	INTRINSIC
low complexity region	1151	1162	N/A	INTRINSIC
low complexity region	1186	1197	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120274
AA Change: T394I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114056
Gene: ENSMUSG00000040624
AA Change: T394I

Domain	Start	End	E-Value	Type
low complexity region	11	30	N/A	INTRINSIC
RhoGEF	116	291	4.17e-52	SMART
PH	323	417	2.54e-6	SMART
low complexity region	419	431	N/A	INTRINSIC
low complexity region	1151	1162	N/A	INTRINSIC
low complexity region	1186	1197	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000136671
AA Change: T449I

SMART Domains

Protein: ENSMUSP00000119950
Gene: ENSMUSG00000040624
AA Change: T449I

Domain	Start	End	E-Value	Type
low complexity region	67	86	N/A	INTRINSIC
RhoGEF	172	347	4.17e-52	SMART
PH	379	473	2.54e-6	SMART
low complexity region	475	487	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1242	1253	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144543

Predicted Effect

unknown
Transcript: ENSMUST00000154727
AA Change: T248I

SMART Domains

Protein: ENSMUSP00000122131
Gene: ENSMUSG00000040624
AA Change: T248I

Domain	Start	End	E-Value	Type
RhoGEF	4	146	2.25e-25	SMART
PH	178	272	2.54e-6	SMART
low complexity region	274	286	N/A	INTRINSIC
low complexity region	1006	1017	N/A	INTRINSIC
low complexity region	1041	1052	N/A	INTRINSIC

Meta Mutation Damage Score

0.1589

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

Allele List at MGI

All alleles(13) : Targeted(2) Gene trapped(11)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Plekhg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01589:Plekhg1	APN	10	3963631	missense	probably benign	0.02
IGL01639:Plekhg1	APN	10	3956751	missense	probably damaging	0.98
IGL01766:Plekhg1	APN	10	3873400	missense	probably damaging	1.00
IGL01983:Plekhg1	APN	10	3945904	missense	probably damaging	1.00
IGL02226:Plekhg1	APN	10	3945916	missense	probably damaging	0.99
IGL02420:Plekhg1	APN	10	3964106	missense	probably damaging	1.00
IGL02441:Plekhg1	APN	10	3958103	missense	possibly damaging	0.89
IGL02505:Plekhg1	APN	10	3957139	missense	probably damaging	0.97
IGL02659:Plekhg1	APN	10	3957069	nonsense	probably null
IGL02730:Plekhg1	APN	10	3873242	missense	possibly damaging	0.59
BB006:Plekhg1	UTSW	10	3919170	missense	probably damaging	0.99
BB016:Plekhg1	UTSW	10	3919170	missense	probably damaging	0.99
PIT4453001:Plekhg1	UTSW	10	3963469	missense
R0041:Plekhg1	UTSW	10	3964076	nonsense	probably null
R0041:Plekhg1	UTSW	10	3964074	missense	probably benign	0.02
R0068:Plekhg1	UTSW	10	3940502	missense	probably damaging	0.99
R0068:Plekhg1	UTSW	10	3940504	nonsense	probably null
R0333:Plekhg1	UTSW	10	3964419	missense	probably damaging	1.00
R0427:Plekhg1	UTSW	10	3964235	missense	probably benign	0.01
R0499:Plekhg1	UTSW	10	3937971	missense	probably damaging	1.00
R0504:Plekhg1	UTSW	10	3937853	missense	probably damaging	1.00
R1499:Plekhg1	UTSW	10	3940538	splice site	probably benign
R1501:Plekhg1	UTSW	10	3957361	missense	probably benign	0.02
R1801:Plekhg1	UTSW	10	3963904	missense	probably damaging	1.00
R1823:Plekhg1	UTSW	10	3903658	critical splice donor site	probably null
R1858:Plekhg1	UTSW	10	3945917	missense	possibly damaging	0.95
R1984:Plekhg1	UTSW	10	3958181	missense	probably damaging	1.00
R2420:Plekhg1	UTSW	10	3958048	missense	probably benign	0.39
R2421:Plekhg1	UTSW	10	3958048	missense	probably benign	0.39
R2422:Plekhg1	UTSW	10	3958048	missense	probably benign	0.39
R2437:Plekhg1	UTSW	10	3963564	missense	probably damaging	1.00
R2872:Plekhg1	UTSW	10	3963982	missense	probably benign
R2872:Plekhg1	UTSW	10	3963982	missense	probably benign
R3830:Plekhg1	UTSW	10	3873400	missense	probably damaging	1.00
R4058:Plekhg1	UTSW	10	3957087	missense	probably damaging	1.00
R4059:Plekhg1	UTSW	10	3957087	missense	probably damaging	1.00
R4649:Plekhg1	UTSW	10	3956985	missense	probably benign	0.00
R4731:Plekhg1	UTSW	10	3957506	missense	probably benign	0.01
R4732:Plekhg1	UTSW	10	3957506	missense	probably benign	0.01
R4733:Plekhg1	UTSW	10	3957506	missense	probably benign	0.01
R4772:Plekhg1	UTSW	10	3873127	missense	probably benign	0.00
R4772:Plekhg1	UTSW	10	3873130	missense	probably damaging	1.00
R4803:Plekhg1	UTSW	10	3957186	missense	probably benign	0.02
R5086:Plekhg1	UTSW	10	3903649	missense	probably damaging	1.00
R5175:Plekhg1	UTSW	10	3965516	unclassified	probably benign
R5283:Plekhg1	UTSW	10	3956654	missense	probably benign	0.00
R5862:Plekhg1	UTSW	10	3937914	missense	probably damaging	1.00
R6163:Plekhg1	UTSW	10	3964369	missense	probably damaging	1.00
R6564:Plekhg1	UTSW	10	3964153	missense	probably damaging	1.00
R6700:Plekhg1	UTSW	10	3957373	missense	probably benign
R6930:Plekhg1	UTSW	10	3963770	missense	possibly damaging	0.56
R7033:Plekhg1	UTSW	10	3940251	missense	probably damaging	0.97
R7200:Plekhg1	UTSW	10	3956810	missense
R7223:Plekhg1	UTSW	10	3873343	missense
R7353:Plekhg1	UTSW	10	3964327	missense
R7488:Plekhg1	UTSW	10	3957491	missense
R7554:Plekhg1	UTSW	10	3963647	missense
R7929:Plekhg1	UTSW	10	3919170	missense	probably damaging	0.99
R8014:Plekhg1	UTSW	10	3957758	missense
R8104:Plekhg1	UTSW	10	3952326	missense
R8167:Plekhg1	UTSW	10	3957452	missense
R8167:Plekhg1	UTSW	10	3957453	missense
R8215:Plekhg1	UTSW	10	3957521	missense
R8263:Plekhg1	UTSW	10	3957651	missense
R8682:Plekhg1	UTSW	10	3947523	missense
R8746:Plekhg1	UTSW	10	3957777	missense
R9148:Plekhg1	UTSW	10	3957527	missense
R9220:Plekhg1	UTSW	10	3963805	missense
R9245:Plekhg1	UTSW	10	3957141	missense
R9520:Plekhg1	UTSW	10	3956822	missense
R9778:Plekhg1	UTSW	10	3937966	missense

Predicted Primers

PCR Primer
(F):5'- TCCAGGAGATCCAGAGCTTGCTAAC -3'
(R):5'- TCTTCAGGTGCAGAACCCAGAGAC -3'

Sequencing Primer
(F):5'- AGCTTGCTAACCAACTGGG -3'
(R):5'- ACGTTTGTCTTGCTGGGATTTG -3'

Posted On

2014-04-24