Incidental Mutation 'R1697:Tfb2m'
ID192301
Institutional Source Beutler Lab
Gene Symbol Tfb2m
Ensembl Gene ENSMUSG00000026492
Gene Nametranscription factor B2, mitochondrial
SynonymsHkp1
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location179528055-179546267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 179544899 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 133 (E133V)
Ref Sequence ENSEMBL: ENSMUSP00000027769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027769] [ENSMUST00000040706]
Predicted Effect probably null
Transcript: ENSMUST00000027769
AA Change: E133V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027769
Gene: ENSMUSG00000026492
AA Change: E133V

DomainStartEndE-ValueType
Pfam:RrnaAD 79 377 6.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040706
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153962
Meta Mutation Damage Score 0.1751 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Tfb2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Tfb2m APN 1 179542313 missense probably damaging 1.00
IGL01415:Tfb2m APN 1 179532130 splice site probably benign
IGL01538:Tfb2m APN 1 179537844 missense possibly damaging 0.87
IGL01939:Tfb2m APN 1 179537697 critical splice donor site probably null
IGL02434:Tfb2m APN 1 179532135 splice site probably benign
IGL02795:Tfb2m APN 1 179545959 missense possibly damaging 0.88
R0267:Tfb2m UTSW 1 179533638 missense probably benign 0.10
R0504:Tfb2m UTSW 1 179545831 missense probably damaging 1.00
R0514:Tfb2m UTSW 1 179531304 missense probably benign 0.05
R0518:Tfb2m UTSW 1 179537824 missense possibly damaging 0.47
R0762:Tfb2m UTSW 1 179545833 missense probably damaging 1.00
R1542:Tfb2m UTSW 1 179537861 splice site probably null
R2421:Tfb2m UTSW 1 179533666 missense possibly damaging 0.56
R5384:Tfb2m UTSW 1 179545872 splice site probably null
R5583:Tfb2m UTSW 1 179545881 missense probably benign 0.16
R6522:Tfb2m UTSW 1 179546046 missense probably benign 0.45
R7425:Tfb2m UTSW 1 179537704 missense probably benign 0.08
R7480:Tfb2m UTSW 1 179529182 missense probably benign
R7846:Tfb2m UTSW 1 179531361 missense probably damaging 1.00
R8207:Tfb2m UTSW 1 179546103 missense probably benign 0.05
R8286:Tfb2m UTSW 1 179529205 missense probably damaging 1.00
R8337:Tfb2m UTSW 1 179542349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTACACCTGAGGGCTTCCAAC -3'
(R):5'- TTGTGGGTTCAAGGTAACTGCCTAATC -3'

Sequencing Primer
(F):5'- TCCAACTGTCCTTTATTCCAAAATAC -3'
(R):5'- aaagacacacacacacacac -3'
Posted On2014-05-14