Incidental Mutation 'R1697:Ctif'
ID192366
Institutional Source Beutler Lab
Gene Symbol Ctif
Ensembl Gene ENSMUSG00000052928
Gene NameCBP80/20-dependent translation initiation factor
SynonymsLOC269037, Gm672
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location75431224-75697696 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 75624305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165559]
Predicted Effect probably benign
Transcript: ENSMUST00000165559
SMART Domains Protein: ENSMUSP00000129974
Gene: ENSMUSG00000052928

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
MIF4G 401 602 5.46e-35 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Ctif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ctif APN 18 75437176 missense possibly damaging 0.95
IGL01481:Ctif APN 18 75611784 splice site probably benign
IGL02299:Ctif APN 18 75637245 missense probably damaging 1.00
IGL02319:Ctif APN 18 75521873 splice site probably benign
IGL03130:Ctif APN 18 75521618 missense probably benign
R0304:Ctif UTSW 18 75521818 missense probably benign 0.09
R0730:Ctif UTSW 18 75565012 missense probably damaging 0.99
R0835:Ctif UTSW 18 75435336 missense probably damaging 1.00
R1226:Ctif UTSW 18 75521579 small deletion probably benign
R1302:Ctif UTSW 18 75521678 missense probably benign 0.22
R1549:Ctif UTSW 18 75565025 missense probably damaging 1.00
R1674:Ctif UTSW 18 75637180 missense probably benign 0.00
R1848:Ctif UTSW 18 75519941 missense probably damaging 0.96
R2102:Ctif UTSW 18 75521381 missense probably benign
R3499:Ctif UTSW 18 75611757 missense possibly damaging 0.94
R3878:Ctif UTSW 18 75519977 missense probably damaging 0.96
R4157:Ctif UTSW 18 75435270 missense probably benign 0.42
R4168:Ctif UTSW 18 75637215 missense probably damaging 1.00
R4225:Ctif UTSW 18 75435237 missense probably benign 0.01
R4560:Ctif UTSW 18 75519881 missense probably damaging 1.00
R4822:Ctif UTSW 18 75521561 missense probably benign 0.01
R5176:Ctif UTSW 18 75637219 missense probably damaging 1.00
R5824:Ctif UTSW 18 75610678 missense possibly damaging 0.55
R6824:Ctif UTSW 18 75521711 missense probably damaging 1.00
R6934:Ctif UTSW 18 75435360 missense probably benign 0.07
R7014:Ctif UTSW 18 75437208 missense possibly damaging 0.82
R7115:Ctif UTSW 18 75471803 critical splice donor site probably benign
R7169:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7187:Ctif UTSW 18 75637219 missense probably damaging 1.00
R7355:Ctif UTSW 18 75610685 missense probably damaging 0.98
R7402:Ctif UTSW 18 75611736 missense probably benign 0.18
R7451:Ctif UTSW 18 75519803 missense possibly damaging 0.82
R7648:Ctif UTSW 18 75637142 missense probably benign 0.04
R7671:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7746:Ctif UTSW 18 75471803 critical splice donor site probably benign
R7765:Ctif UTSW 18 75605644 missense probably damaging 1.00
R7805:Ctif UTSW 18 75471803 critical splice donor site probably benign
X0027:Ctif UTSW 18 75637263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCATCCTTTAGGAAAGTCACCC -3'
(R):5'- CCAGGAGAGGAGTTGTGCCAATATG -3'

Sequencing Primer
(F):5'- TTTAGGAAAGTCACCCAAGAGTC -3'
(R):5'- tcccctatcacccaccttc -3'
Posted On2014-05-14