Mutagenetix > Incidental Mutation

Incidental Mutation 'R1697:Ctif'

192366

Institutional Source

Beutler Lab

Gene Symbol

Ctif

Ensembl Gene

ENSMUSG00000052928

Gene Name

CBP80/20-dependent translation initiation factor

Synonyms

LOC269037, Gm672

MMRRC Submission

039730-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R1697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75431224-75697696 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 75624305 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165559]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000165559

SMART Domains

Protein: ENSMUSP00000129974
Gene: ENSMUSG00000052928

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	188	204	N/A	INTRINSIC
low complexity region	347	360	N/A	INTRINSIC
MIF4G	401	602	5.46e-35	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]).[supplied by OMIM, Dec 2009]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,845,114	D250E	probably damaging	Het
4930571K23Rik	A	G	7: 125,369,029		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,154,347	C1579S	probably damaging	Het
Acsl3	T	C	1: 78,705,397		probably benign	Het
Acsl6	C	A	11: 54,329,966	T244K	probably damaging	Het
Adam26b	T	A	8: 43,520,963	N334I	probably damaging	Het
Adgrl4	C	T	3: 151,517,611	T608M	probably damaging	Het
Aldh2	A	G	5: 121,578,341		probably null	Het
Alms1	A	G	6: 85,622,454	T1890A	possibly damaging	Het
C87977	A	C	4: 144,208,592	I193S	probably damaging	Het
Capn7	C	T	14: 31,360,160	T441M	probably damaging	Het
Cd9	A	T	6: 125,464,404	C85S	probably damaging	Het
Chrm3	T	C	13: 9,878,758	T81A	probably damaging	Het
Dcc	T	A	18: 71,370,737	D950V	probably damaging	Het
Eif4g1	T	C	16: 20,679,780	V422A	probably damaging	Het
Enthd1	A	G	15: 80,452,923	S437P	probably damaging	Het
Fads1	A	G	19: 10,194,100		probably benign	Het
Fat3	T	A	9: 15,944,880	I3869L	probably benign	Het
Fbxw5	T	A	2: 25,502,461	V85E	possibly damaging	Het
Fem1b	T	C	9: 62,797,174	D268G	possibly damaging	Het
Focad	T	C	4: 88,408,988	L1772P	probably damaging	Het
Gm9573	A	C	17: 35,620,648		probably benign	Het
Gm9833	G	A	3: 10,089,553	V461I	possibly damaging	Het
Gtf3a	C	A	5: 146,951,913	Q145K	possibly damaging	Het
Hacl1	T	C	14: 31,621,000		probably null	Het
Herc2	T	A	7: 56,153,905	F2229L	probably benign	Het
Hs3st4	A	T	7: 124,396,857	I249L	probably benign	Het
Iqsec1	A	T	6: 90,809,770	Y7*	probably null	Het
Klk1b1	T	A	7: 43,970,326	M103K	probably benign	Het
Krt5	A	G	15: 101,710,585	V287A	probably benign	Het
Lgals12	T	A	19: 7,604,165	Q59L	possibly damaging	Het
Loxl4	A	G	19: 42,604,940	V264A	possibly damaging	Het
Lrmp	A	G	6: 145,137,615		probably benign	Het
Lrp1b	T	C	2: 40,822,683	D3099G	probably damaging	Het
Mical3	G	A	6: 121,007,408	T169I	possibly damaging	Het
Myh7b	A	C	2: 155,620,134	S317R	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nsd1	A	T	13: 55,214,059		probably null	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr152	T	A	2: 87,782,585	I15N	possibly damaging	Het
Olfr190	A	G	16: 59,074,907	Y58H	probably damaging	Het
Olfr331	A	T	11: 58,501,676	S293R	probably damaging	Het
Olfr346	C	T	2: 36,688,247	L82F	probably damaging	Het
Olfr769	T	C	10: 129,111,868	T186A	probably benign	Het
Pcnx2	A	G	8: 125,850,348	Y982H	probably damaging	Het
Pias3	T	C	3: 96,702,225	L312P	probably damaging	Het
Plekhm1	G	A	11: 103,376,884	P754S	probably damaging	Het
Ppp2r5c	T	A	12: 110,561,472		probably benign	Het
Ppp2r5c	T	A	12: 110,545,623	L145*	probably null	Het
Proser3	T	C	7: 30,540,021	M553V	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Smurf2	A	T	11: 106,824,688	D664E	possibly damaging	Het
Spag9	G	A	11: 93,996,565	A99T	probably benign	Het
Stim1	T	G	7: 102,354,506	C49G	probably damaging	Het
Stk32c	T	C	7: 139,121,824	I238V	probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tfb2m	T	A	1: 179,544,899	E133V	probably null	Het
Tmem209	A	T	6: 30,497,868	C143S	probably benign	Het
Tnr	T	G	1: 159,852,030	N191K	probably benign	Het
Vars	C	T	17: 34,998,222	A419T	probably benign	Het
Vmn2r111	T	C	17: 22,548,060	S819G	probably benign	Het
Wls	T	C	3: 159,897,358	V136A	probably benign	Het
Ybx2	C	T	11: 69,940,061	S217L	probably benign	Het
Zfp82	T	C	7: 30,057,354	D37G	probably benign	Het

Other mutations in Ctif

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Ctif	APN	18	75437176	missense	possibly damaging	0.95
IGL01481:Ctif	APN	18	75611784	splice site	probably benign
IGL02299:Ctif	APN	18	75637245	missense	probably damaging	1.00
IGL02319:Ctif	APN	18	75521873	splice site	probably benign
IGL03130:Ctif	APN	18	75521618	missense	probably benign
R0304:Ctif	UTSW	18	75521818	missense	probably benign	0.09
R0730:Ctif	UTSW	18	75565012	missense	probably damaging	0.99
R0835:Ctif	UTSW	18	75435336	missense	probably damaging	1.00
R1226:Ctif	UTSW	18	75521579	small deletion	probably benign
R1302:Ctif	UTSW	18	75521678	missense	probably benign	0.22
R1549:Ctif	UTSW	18	75565025	missense	probably damaging	1.00
R1674:Ctif	UTSW	18	75637180	missense	probably benign	0.00
R1848:Ctif	UTSW	18	75519941	missense	probably damaging	0.96
R2102:Ctif	UTSW	18	75521381	missense	probably benign
R3499:Ctif	UTSW	18	75611757	missense	possibly damaging	0.94
R3878:Ctif	UTSW	18	75519977	missense	probably damaging	0.96
R4157:Ctif	UTSW	18	75435270	missense	probably benign	0.42
R4168:Ctif	UTSW	18	75637215	missense	probably damaging	1.00
R4225:Ctif	UTSW	18	75435237	missense	probably benign	0.01
R4560:Ctif	UTSW	18	75519881	missense	probably damaging	1.00
R4822:Ctif	UTSW	18	75521561	missense	probably benign	0.01
R5176:Ctif	UTSW	18	75637219	missense	probably damaging	1.00
R5824:Ctif	UTSW	18	75610678	missense	possibly damaging	0.55
R6824:Ctif	UTSW	18	75521711	missense	probably damaging	1.00
R6934:Ctif	UTSW	18	75435360	missense	probably benign	0.07
R7014:Ctif	UTSW	18	75437208	missense	possibly damaging	0.82
R7115:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R7169:Ctif	UTSW	18	75472016	missense	probably damaging	0.99
R7187:Ctif	UTSW	18	75637219	missense	probably damaging	1.00
R7355:Ctif	UTSW	18	75610685	missense	probably damaging	0.98
R7402:Ctif	UTSW	18	75611736	missense	probably benign	0.18
R7451:Ctif	UTSW	18	75519803	missense	possibly damaging	0.82
R7648:Ctif	UTSW	18	75637142	missense	probably benign	0.04
R7671:Ctif	UTSW	18	75472016	missense	probably damaging	0.99
R7746:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R7765:Ctif	UTSW	18	75605644	missense	probably damaging	1.00
R8151:Ctif	UTSW	18	75520105	missense	probably benign
R8358:Ctif	UTSW	18	75565044	missense	possibly damaging	0.68
R8782:Ctif	UTSW	18	75521797	missense	probably benign	0.35
R8829:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R8963:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R9032:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R9069:Ctif	UTSW	18	75521387	missense	probably damaging	0.99
R9631:Ctif	UTSW	18	75471954	missense	probably benign	0.03
R9645:Ctif	UTSW	18	75624281	missense	probably benign	0.20
X0027:Ctif	UTSW	18	75637263	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCATCCTTTAGGAAAGTCACCC -3'
(R):5'- CCAGGAGAGGAGTTGTGCCAATATG -3'

Sequencing Primer
(F):5'- TTTAGGAAAGTCACCCAAGAGTC -3'
(R):5'- tcccctatcacccaccttc -3'

Posted On

2014-05-14