Incidental Mutation 'R1697:Wls'
ID192312
Institutional Source Beutler Lab
Gene Symbol Wls
Ensembl Gene ENSMUSG00000028173
Gene Namewntless WNT ligand secretion mediator
Synonyms5031439A09Rik, Gpr177
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location159839672-159938664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 159897358 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 136 (V136A)
Ref Sequence ENSEMBL: ENSMUSP00000143475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068952] [ENSMUST00000198878] [ENSMUST00000200191]
Predicted Effect probably benign
Transcript: ENSMUST00000068952
AA Change: V136A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067898
Gene: ENSMUSG00000028173
AA Change: V136A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 178 496 3.7e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197328
Predicted Effect probably benign
Transcript: ENSMUST00000198878
AA Change: V136A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143475
Gene: ENSMUSG00000028173
AA Change: V136A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 177 497 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200571
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for null alleles exhibit impaired body axis and triploblastic development dying prior to E10.5. Mice homozygous for a floxed allele activated in keratinocytes exhibit a psoriasiform dermatitis-like phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Wls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Wls APN 3 159901443 nonsense probably null
IGL02065:Wls APN 3 159911356 missense probably damaging 0.99
IGL02073:Wls APN 3 159907253 critical splice donor site probably null
IGL02133:Wls APN 3 159897370 missense probably damaging 1.00
R0374:Wls UTSW 3 159897437 nonsense probably null
R0561:Wls UTSW 3 159873068 missense probably benign 0.32
R1791:Wls UTSW 3 159911813 missense probably benign 0.17
R2444:Wls UTSW 3 159907230 missense probably damaging 1.00
R3161:Wls UTSW 3 159897436 missense probably damaging 1.00
R4285:Wls UTSW 3 159934266 missense probably benign
R4468:Wls UTSW 3 159872927 missense probably damaging 0.96
R4472:Wls UTSW 3 159897383 missense probably benign 0.01
R4782:Wls UTSW 3 159897445 missense probably benign 0.03
R4799:Wls UTSW 3 159897445 missense probably benign 0.03
R4809:Wls UTSW 3 159897445 missense probably benign 0.03
R5006:Wls UTSW 3 159911791 missense possibly damaging 0.68
R5212:Wls UTSW 3 159873008 missense probably benign 0.15
R5434:Wls UTSW 3 159934340 missense probably damaging 0.97
R5694:Wls UTSW 3 159839987 missense probably benign 0.01
R6315:Wls UTSW 3 159934371 critical splice donor site probably null
R7069:Wls UTSW 3 159934329 missense probably damaging 1.00
R7243:Wls UTSW 3 159909765 missense possibly damaging 0.49
R7529:Wls UTSW 3 159873007 missense probably benign 0.43
R7697:Wls UTSW 3 159911318 missense probably benign 0.21
R7842:Wls UTSW 3 159873179 missense probably benign 0.09
R8136:Wls UTSW 3 159873124 missense probably damaging 1.00
R8536:Wls UTSW 3 159873111 missense probably damaging 0.96
R8816:Wls UTSW 3 159934292 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGAGCATCTGAGCTGCTTGAGTCC -3'
(R):5'- GGTAGTACTCCATGCCAAGAATCCAAC -3'

Sequencing Primer
(F):5'- TCTTGACTGCAAAGGGTAGGC -3'
(R):5'- CACTGTCAACTCAGCAATAAAGG -3'
Posted On2014-05-14