Mutagenetix > Incidental Mutation

Incidental Mutation 'R0051:Abr'

192639

Institutional Source

Beutler Lab

Gene Symbol

Abr

Ensembl Gene

ENSMUSG00000017631

Gene Name

active BCR-related gene

Synonyms

6330400K15Rik

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R0051 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

76416734-76622314 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76472502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 163 (Q163L)

Ref Sequence

ENSEMBL: ENSMUSP00000104044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065028] [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000108408] [ENSMUST00000151526]

AlphaFold

Q5SSL4

Predicted Effect

probably benign
Transcript: ENSMUST00000065028

SMART Domains

Protein: ENSMUSP00000068982
Gene: ENSMUSG00000017631

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	12	65	5.4e-11	PFAM
PH	84	243	1.58e-11	SMART
C2	287	394	1.88e-11	SMART
RhoGAP	440	619	6.57e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000072740
AA Change: Q209L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631
AA Change: Q209L

Domain	Start	End	E-Value	Type
RhoGEF	95	283	2.37e-56	SMART
PH	302	461	1.58e-11	SMART
C2	505	612	1.88e-11	SMART
RhoGAP	658	837	6.57e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094012
AA Change: Q221L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631
AA Change: Q221L

Domain	Start	End	E-Value	Type
RhoGEF	107	295	2.37e-56	SMART
PH	314	473	1.58e-11	SMART
C2	517	624	1.88e-11	SMART
RhoGAP	670	849	6.57e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108407
AA Change: Q163L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631
AA Change: Q163L

Domain	Start	End	E-Value	Type
RhoGEF	49	237	2.37e-56	SMART
PH	256	415	1.58e-11	SMART
C2	459	566	1.88e-11	SMART
RhoGAP	612	791	6.57e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108408
AA Change: Q172L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000104045
Gene: ENSMUSG00000017631
AA Change: Q172L

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
RhoGEF	58	246	2.37e-56	SMART
PH	265	424	1.58e-11	SMART
C2	468	575	1.88e-11	SMART
RhoGAP	621	800	6.57e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130364

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141442

Predicted Effect

probably benign
Transcript: ENSMUST00000151526
AA Change: Q119L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135544
Gene: ENSMUSG00000017631
AA Change: Q119L

Domain	Start	End	E-Value	Type
RhoGEF	5	161	3.85e-24	SMART

Meta Mutation Damage Score

0.1158

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mutants are apparently normal, but double knockouts with Bcr show increased postnatal mortality, ataxia, hyperactivity, circling, lack of vestibular otoconia, ectopic cerebellar granule cells, and foliation defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Abr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Abr	APN	11	76423089	missense	probably damaging	0.96
IGL00571:Abr	APN	11	76468740	missense	probably benign	0.45
IGL01774:Abr	APN	11	76464299	splice site	probably benign
IGL02208:Abr	APN	11	76455645	missense	probably damaging	1.00
IGL02477:Abr	APN	11	76461360	missense	probably damaging	1.00
IGL02499:Abr	APN	11	76509090	missense	probably benign	0.39
IGL02606:Abr	APN	11	76479164	missense	probably damaging	1.00
IGL02955:Abr	APN	11	76419165	missense	probably damaging	1.00
IGL03136:Abr	APN	11	76425295	nonsense	probably null
R0311:Abr	UTSW	11	76509127	missense	possibly damaging	0.83
R0344:Abr	UTSW	11	76479044	missense	probably damaging	0.99
R0621:Abr	UTSW	11	76509072	missense	probably damaging	1.00
R0771:Abr	UTSW	11	76455683	missense	probably damaging	1.00
R1081:Abr	UTSW	11	76455615	missense	probably damaging	1.00
R1842:Abr	UTSW	11	76508986	missense	probably damaging	1.00
R2036:Abr	UTSW	11	76452350	missense	probably benign	0.08
R2147:Abr	UTSW	11	76455648	missense	probably damaging	1.00
R2250:Abr	UTSW	11	76451939	missense	probably damaging	1.00
R3153:Abr	UTSW	11	76486469	missense	probably damaging	1.00
R3928:Abr	UTSW	11	76468735	missense	probably benign	0.01
R4507:Abr	UTSW	11	76451857	missense	possibly damaging	0.65
R4518:Abr	UTSW	11	76472518	missense	possibly damaging	0.72
R4632:Abr	UTSW	11	76509019	missense	probably benign	0.10
R4751:Abr	UTSW	11	76456608	missense	possibly damaging	0.79
R4853:Abr	UTSW	11	76464261	missense	probably damaging	1.00
R5255:Abr	UTSW	11	76455683	missense	probably damaging	1.00
R5693:Abr	UTSW	11	76463577	missense	probably damaging	1.00
R6459:Abr	UTSW	11	76424989	missense	probably damaging	0.98
R6478:Abr	UTSW	11	76452332	missense	probably damaging	0.99
R7030:Abr	UTSW	11	76459212	missense	probably damaging	1.00
R7221:Abr	UTSW	11	76423161	missense	probably benign	0.09
R8353:Abr	UTSW	11	76419833	missense	probably damaging	1.00
R8362:Abr	UTSW	11	76479128	missense	probably benign	0.00
R8962:Abr	UTSW	11	76461329	missense	probably damaging	1.00
R8967:Abr	UTSW	11	76479029	missense	possibly damaging	0.52
R9130:Abr	UTSW	11	76451927	missense	possibly damaging	0.91
R9275:Abr	UTSW	11	76464282	missense	probably damaging	1.00
R9492:Abr	UTSW	11	76508925	missense	probably benign
R9516:Abr	UTSW	11	76419832	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCAAAGGTTGGGAAGTCACTTG -3'
(R):5'- ACCTTGTTACCCTTATTGGCTGAGC -3'

Sequencing Primer
(F):5'- gttgggaagtcacttgGGAAG -3'
(R):5'- CTGTCAAGTTCAAAGGGATACTG -3'

Posted On

2014-05-20