Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:Drd5'

64281

Institutional Source

Beutler Lab

Gene Symbol

Drd5

Ensembl Gene

ENSMUSG00000039358

Gene Name

dopamine receptor D5

Synonyms

D5R, Gpcr1, Drd1b, Drd-5, DRD1b

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R0051 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38319367-38322518 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 38320614 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 317 (S317G)

Ref Sequence

ENSEMBL: ENSMUSP00000039691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041646]

Predicted Effect

probably benign
Transcript: ENSMUST00000041646
AA Change: S317G

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000039691
Gene: ENSMUSG00000039358
AA Change: S317G

Domain	Start	End	E-Value	Type
low complexity region	26	37	N/A	INTRINSIC
Pfam:7TM_GPCR_Srx	47	177	5.5e-7	PFAM
Pfam:7TM_GPCR_Srsx	49	179	1e-7	PFAM
Pfam:7tm_1	55	354	1.5e-74	PFAM
Pfam:7TM_GPCR_Srsx	210	368	2.4e-6	PFAM
low complexity region	419	430	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181240

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D5 subtype of the dopamine receptor. The D5 subtype is a G-protein coupled receptor which stimulates adenylyl cyclase. This receptor is expressed in neurons in the limbic regions of the brain. It has a 10-fold higher affinity for dopamine than the D1 subtype. Pseudogenes related to this gene reside on chromosomes 1 and 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop hypertension and exhibit elevated blood pressure caused by increased sympathetic tone. Mice homozygous for another knock-out allele exhibit increased methamphetamine-induced ambulatory activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Drd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03153:Drd5	APN	5	38319781	missense	probably benign	0.25
PIT4305001:Drd5	UTSW	5	38320584	missense	probably damaging	1.00
R0051:Drd5	UTSW	5	38320614	missense	probably benign	0.39
R0571:Drd5	UTSW	5	38319927	missense	probably damaging	1.00
R1507:Drd5	UTSW	5	38320722	missense	probably damaging	1.00
R1663:Drd5	UTSW	5	38320855	missense	probably benign	0.02
R1777:Drd5	UTSW	5	38320161	missense	probably damaging	1.00
R1932:Drd5	UTSW	5	38319976	missense	probably benign	0.14
R1986:Drd5	UTSW	5	38320113	missense	probably damaging	0.99
R2047:Drd5	UTSW	5	38320336	missense	probably damaging	1.00
R3875:Drd5	UTSW	5	38319814	missense	possibly damaging	0.84
R5033:Drd5	UTSW	5	38320201	missense	probably damaging	1.00
R5201:Drd5	UTSW	5	38320023	missense	probably damaging	0.96
R5255:Drd5	UTSW	5	38319967	missense	probably damaging	1.00
R5393:Drd5	UTSW	5	38320905	missense	probably benign
R5639:Drd5	UTSW	5	38319835	missense	possibly damaging	0.81
R7241:Drd5	UTSW	5	38320536	missense	probably damaging	1.00
R7520:Drd5	UTSW	5	38320852	missense	probably benign	0.00
R7739:Drd5	UTSW	5	38320078	missense	probably damaging	1.00
R8300:Drd5	UTSW	5	38320329	missense	probably damaging	0.99
R8746:Drd5	UTSW	5	38320090	missense	probably benign	0.04
R8829:Drd5	UTSW	5	38319735	missense	probably benign	0.08
R8832:Drd5	UTSW	5	38319735	missense	probably benign	0.08
R8870:Drd5	UTSW	5	38320404	missense	possibly damaging	0.76
Z1177:Drd5	UTSW	5	38320386	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- ACAGGTTCAGATCCGCCGTATCTC -3'
(R):5'- AGACATGTGATCGAAAGGCCCCTC -3'

Sequencing Primer
(F):5'- GTATCTCCTCCCTAGAAAGGGC -3'
(R):5'- ctcctcctcctctcccac -3'

Posted On

2013-08-06