Incidental Mutation 'R0051:Rbm26'
Institutional Source Beutler Lab
Gene Symbol Rbm26
Ensembl Gene ENSMUSG00000022119
Gene NameRNA binding motif protein 26
Synonyms1700009P03Rik, Pro1777, C230097K14Rik
MMRRC Submission 038345-MU
Accession Numbers

Genbank: NM_134077; MGI: 1921463

Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R0051 (G1)
Quality Score167
Status Validated
Chromosomal Location105106751-105177327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105152540 bp
Amino Acid Change Valine to Glycine at position 216 (V216G)
Ref Sequence ENSEMBL: ENSMUSP00000126414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022715] [ENSMUST00000100327] [ENSMUST00000163499] [ENSMUST00000163545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022715
AA Change: V216G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022715
Gene: ENSMUSG00000022119
AA Change: V216G

Pfam:PWI 10 80 1.1e-9 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 722 735 N/A INTRINSIC
Blast:RRM_2 753 820 6e-19 BLAST
low complexity region 848 879 N/A INTRINSIC
RRM 892 956 2.1e-1 SMART
low complexity region 970 1002 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100327
AA Change: V216G

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097901
Gene: ENSMUSG00000022119
AA Change: V216G

Pfam:PWI 10 80 6.1e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 698 711 N/A INTRINSIC
Blast:RRM_2 729 796 6e-19 BLAST
low complexity region 824 855 N/A INTRINSIC
RRM 868 932 2.1e-1 SMART
low complexity region 946 978 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163499
AA Change: V216G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128197
Gene: ENSMUSG00000022119
AA Change: V216G

Pfam:PWI 10 80 6.2e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 727 740 N/A INTRINSIC
Blast:RRM_2 758 825 6e-19 BLAST
low complexity region 853 884 N/A INTRINSIC
RRM 897 961 2.1e-1 SMART
low complexity region 975 983 N/A INTRINSIC
low complexity region 986 1001 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163545
AA Change: V216G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126414
Gene: ENSMUSG00000022119
AA Change: V216G

Pfam:PWI 11 81 1.5e-11 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 724 737 N/A INTRINSIC
Blast:RRM_2 755 822 6e-19 BLAST
low complexity region 850 881 N/A INTRINSIC
RRM 894 958 2.1e-1 SMART
low complexity region 972 1004 N/A INTRINSIC
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
Allele List at MGI

All alleles(33) : Gene trapped(33)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Serpina10 A G 12: 103,626,897 probably benign Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Rbm26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Rbm26 APN 14 105159960 missense unknown
IGL00948:Rbm26 APN 14 105150343 missense probably damaging 1.00
IGL01584:Rbm26 APN 14 105131532 missense probably damaging 0.99
IGL01726:Rbm26 APN 14 105152507 missense probably damaging 0.99
IGL02095:Rbm26 APN 14 105144260 missense probably damaging 1.00
IGL03306:Rbm26 APN 14 105151322 missense probably damaging 0.99
monte UTSW 14 105142834 missense probably benign 0.12
D4043:Rbm26 UTSW 14 105152540 missense possibly damaging 0.59
I0000:Rbm26 UTSW 14 105153567 missense unknown
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0243:Rbm26 UTSW 14 105131938 missense probably benign 0.22
R0738:Rbm26 UTSW 14 105176782 missense unknown
R1566:Rbm26 UTSW 14 105160544 missense unknown
R1645:Rbm26 UTSW 14 105150817 missense probably damaging 1.00
R1789:Rbm26 UTSW 14 105117073 missense probably benign 0.32
R1809:Rbm26 UTSW 14 105117106 splice site probably benign
R2144:Rbm26 UTSW 14 105115202 nonsense probably null
R2321:Rbm26 UTSW 14 105153427 missense unknown
R2495:Rbm26 UTSW 14 105151312 splice site probably benign
R2906:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2907:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2908:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R3034:Rbm26 UTSW 14 105153445 missense unknown
R3427:Rbm26 UTSW 14 105131532 missense probably damaging 0.99
R3818:Rbm26 UTSW 14 105141270 missense probably damaging 0.99
R3863:Rbm26 UTSW 14 105121068 missense probably damaging 0.99
R4448:Rbm26 UTSW 14 105151550 missense probably damaging 0.99
R5022:Rbm26 UTSW 14 105144252 missense probably damaging 1.00
R5040:Rbm26 UTSW 14 105121016 missense probably benign 0.05
R5626:Rbm26 UTSW 14 105144231 missense probably benign 0.43
R5817:Rbm26 UTSW 14 105128603 missense probably damaging 1.00
R5960:Rbm26 UTSW 14 105150315 missense probably damaging 1.00
R6318:Rbm26 UTSW 14 105131535 missense probably damaging 0.99
R6608:Rbm26 UTSW 14 105152498 missense probably damaging 1.00
R6821:Rbm26 UTSW 14 105116964 intron probably benign
R7075:Rbm26 UTSW 14 105160607 missense unknown
R7136:Rbm26 UTSW 14 105144267 missense possibly damaging 0.88
R7340:Rbm26 UTSW 14 105152540 missense possibly damaging 0.86
R7431:Rbm26 UTSW 14 105117092 missense possibly damaging 0.71
R7554:Rbm26 UTSW 14 105160593 missense unknown
R7638:Rbm26 UTSW 14 105150848 missense probably damaging 1.00
R8192:Rbm26 UTSW 14 105142689 critical splice donor site probably null
R8536:Rbm26 UTSW 14 105142838 missense possibly damaging 0.88
RF004:Rbm26 UTSW 14 105151495 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tctcctcccaactccttctc -3'
Posted On2013-08-06