Mutagenetix > Incidental Mutation

Incidental Mutation 'R0051:Yeats2'

192641

Institutional Source

Beutler Lab

Gene Symbol

Yeats2

Ensembl Gene

ENSMUSG00000041215

Gene Name

YEATS domain containing 2

Synonyms

MMRRC Submission

038345-MU

Accession Numbers

Ncbi RefSeq: NM_001145930.1, NM_001033237.2, NM_001145931.1; MGI:2447762

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R0051 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

20141063-20232573 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 20193724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 557 (Y557*)

Ref Sequence

ENSEMBL: ENSMUSP00000155891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000232019] [ENSMUST00000232338]

AlphaFold

Q3TUF7

Predicted Effect

probably null
Transcript: ENSMUST00000090052
AA Change: Y560*

SMART Domains

Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215
AA Change: Y560*

Domain	Start	End	E-Value	Type
Pfam:YEATS	179	262	2.6e-27	PFAM
low complexity region	299	309	N/A	INTRINSIC
low complexity region	312	333	N/A	INTRINSIC
low complexity region	409	429	N/A	INTRINSIC
low complexity region	458	467	N/A	INTRINSIC
internal_repeat_1	471	675	3.72e-6	PROSPERO
low complexity region	683	702	N/A	INTRINSIC
low complexity region	738	775	N/A	INTRINSIC
internal_repeat_1	785	978	3.72e-6	PROSPERO
low complexity region	1240	1249	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115560
AA Change: Y613*

SMART Domains

Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215
AA Change: Y613*

Domain	Start	End	E-Value	Type
Pfam:YEATS	232	314	2.1e-28	PFAM
low complexity region	352	362	N/A	INTRINSIC
low complexity region	365	386	N/A	INTRINSIC
low complexity region	462	482	N/A	INTRINSIC
low complexity region	511	520	N/A	INTRINSIC
internal_repeat_1	524	728	4.68e-6	PROSPERO
low complexity region	736	755	N/A	INTRINSIC
low complexity region	791	828	N/A	INTRINSIC
internal_repeat_1	838	1031	4.68e-6	PROSPERO
low complexity region	1293	1302	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231671

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231795

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231861

Predicted Effect

probably null
Transcript: ENSMUST00000232019
AA Change: Y575*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232172

Predicted Effect

probably null
Transcript: ENSMUST00000232338
AA Change: Y557*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]

Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Yeats2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01118:Yeats2	APN	16	20186304	missense	probably damaging	0.99
IGL01128:Yeats2	APN	16	20161968	splice site	probably benign
IGL01139:Yeats2	APN	16	20214393	missense	probably damaging	1.00
IGL01394:Yeats2	APN	16	20162032	missense	probably damaging	0.99
IGL01482:Yeats2	APN	16	20222921	missense	probably damaging	1.00
IGL01924:Yeats2	APN	16	20206167	missense	probably damaging	1.00
IGL01925:Yeats2	APN	16	20179680	splice site	probably benign
IGL02106:Yeats2	APN	16	20193220	missense	possibly damaging	0.79
IGL02370:Yeats2	APN	16	20150471	missense	probably damaging	0.99
IGL02447:Yeats2	APN	16	20193679	missense	probably benign	0.00
IGL02669:Yeats2	APN	16	20186283	missense	probably benign	0.13
IGL03155:Yeats2	APN	16	20229573	critical splice donor site	probably null
tyrion	UTSW	16	20213401	splice site	probably benign
P0045:Yeats2	UTSW	16	20156945	missense	possibly damaging	0.47
R0051:Yeats2	UTSW	16	20193724	nonsense	probably null
R0118:Yeats2	UTSW	16	20156942	nonsense	probably null
R0157:Yeats2	UTSW	16	20221677	makesense	probably null
R0184:Yeats2	UTSW	16	20203685	missense	possibly damaging	0.79
R0194:Yeats2	UTSW	16	20152969	start codon destroyed	probably null	1.00
R0612:Yeats2	UTSW	16	20186425	missense	probably benign	0.00
R0655:Yeats2	UTSW	16	20193824	nonsense	probably null
R0826:Yeats2	UTSW	16	20193216	nonsense	probably null
R1526:Yeats2	UTSW	16	20206086	missense	probably damaging	1.00
R1535:Yeats2	UTSW	16	20189365	missense	probably damaging	0.99
R1749:Yeats2	UTSW	16	20186268	nonsense	probably null
R1842:Yeats2	UTSW	16	20171238	missense	probably damaging	1.00
R1843:Yeats2	UTSW	16	20229564	missense	probably benign	0.01
R1926:Yeats2	UTSW	16	20214426	missense	probably benign
R2000:Yeats2	UTSW	16	20186391	missense	probably benign	0.20
R2017:Yeats2	UTSW	16	20159181	missense	probably benign	0.01
R2076:Yeats2	UTSW	16	20186282	missense	possibly damaging	0.47
R2153:Yeats2	UTSW	16	20154166	missense	probably damaging	1.00
R2167:Yeats2	UTSW	16	20213401	splice site	probably benign
R2981:Yeats2	UTSW	16	20186301	missense	probably damaging	0.99
R3160:Yeats2	UTSW	16	20193645	missense	probably damaging	1.00
R3161:Yeats2	UTSW	16	20193645	missense	probably damaging	1.00
R3162:Yeats2	UTSW	16	20193645	missense	probably damaging	1.00
R3774:Yeats2	UTSW	16	20150495	missense	probably damaging	1.00
R4250:Yeats2	UTSW	16	20156935	missense	possibly damaging	0.90
R4305:Yeats2	UTSW	16	20208422	missense	probably damaging	1.00
R4455:Yeats2	UTSW	16	20161993	missense	possibly damaging	0.88
R4458:Yeats2	UTSW	16	20213321	missense	probably damaging	0.99
R4811:Yeats2	UTSW	16	20152895	splice site	probably null
R4902:Yeats2	UTSW	16	20207668	missense	probably benign	0.00
R5043:Yeats2	UTSW	16	20208465	missense	probably damaging	1.00
R5047:Yeats2	UTSW	16	20208465	missense	probably damaging	1.00
R5319:Yeats2	UTSW	16	20186425	missense	probably benign	0.01
R5328:Yeats2	UTSW	16	20171205	missense	probably damaging	1.00
R5360:Yeats2	UTSW	16	20154162	missense	probably damaging	0.97
R5416:Yeats2	UTSW	16	20211569	missense	probably benign	0.01
R5672:Yeats2	UTSW	16	20162029	missense	probably damaging	1.00
R5684:Yeats2	UTSW	16	20193803	missense	possibly damaging	0.94
R5932:Yeats2	UTSW	16	20193163	missense	probably benign	0.06
R5946:Yeats2	UTSW	16	20207763	nonsense	probably null
R6168:Yeats2	UTSW	16	20179558	missense	probably benign	0.01
R6169:Yeats2	UTSW	16	20219667	missense	probably damaging	1.00
R6179:Yeats2	UTSW	16	20214475	missense	probably benign	0.16
R6371:Yeats2	UTSW	16	20221710	missense	possibly damaging	0.54
R6877:Yeats2	UTSW	16	20179594	missense	probably benign	0.00
R7149:Yeats2	UTSW	16	20154189	missense	probably damaging	1.00
R7405:Yeats2	UTSW	16	20222913	missense	probably damaging	1.00
R8353:Yeats2	UTSW	16	20222887	nonsense	probably null
R8367:Yeats2	UTSW	16	20222825	missense	probably damaging	1.00
R8453:Yeats2	UTSW	16	20222887	nonsense	probably null
R8506:Yeats2	UTSW	16	20152934	missense	probably damaging	0.98
R8535:Yeats2	UTSW	16	20159176	missense	probably damaging	1.00
R8828:Yeats2	UTSW	16	20150510	missense	probably benign	0.45
R8905:Yeats2	UTSW	16	20190394	missense	probably benign	0.02
R8924:Yeats2	UTSW	16	20150562	critical splice donor site	probably null
R9087:Yeats2	UTSW	16	20211750	critical splice donor site	probably null
R9276:Yeats2	UTSW	16	20157036	missense	probably benign	0.34
R9338:Yeats2	UTSW	16	20213328	missense	possibly damaging	0.69
R9338:Yeats2	UTSW	16	20222783	missense	probably damaging	0.99
R9378:Yeats2	UTSW	16	20214478	missense	probably benign
R9569:Yeats2	UTSW	16	20154152	missense	probably damaging	1.00
R9664:Yeats2	UTSW	16	20228741	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCCGTCTCTATGACAAGTGACAG -3'
(R):5'- GTTCAGAGCAGCACTCTCTTACAGG -3'

Sequencing Primer
(F):5'- GAGCCGTTCTGTGTATCCAAAC -3'
(R):5'- CTAGAGAGAGGATACTTTGTCCC -3'

Posted On

2014-05-20