Incidental Mutation 'R1783:Pik3c2b'
ID 195524
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 039814-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.219) question?
Stock # R1783 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 132994365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 110 (P110S)
Ref Sequence ENSEMBL: ENSMUSP00000115469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]
AlphaFold E9QAN8
Predicted Effect probably benign
Transcript: ENSMUST00000077730
AA Change: P110S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: P110S

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145153
Predicted Effect probably benign
Transcript: ENSMUST00000153707
AA Change: P110S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447
AA Change: P110S

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186515
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 226 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,088,286 (GRCm39) T307S probably damaging Het
4930590J08Rik T C 6: 91,896,259 (GRCm39) I369T possibly damaging Het
Abhd17a T A 10: 80,419,860 (GRCm39) I115F probably benign Het
Acacb TGGGG TGGG 5: 114,347,828 (GRCm39) probably null Het
Adgrb2 C T 4: 129,903,098 (GRCm39) T566I possibly damaging Het
Adgrf4 C T 17: 42,977,789 (GRCm39) R518Q possibly damaging Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Bbs9 T C 9: 22,570,415 (GRCm39) V587A possibly damaging Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Capn8 T C 1: 182,426,387 (GRCm39) S241P probably damaging Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cep350 A C 1: 155,804,611 (GRCm39) L824R probably damaging Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Chit1 A G 1: 134,077,132 (GRCm39) R312G possibly damaging Het
Chit1 G T 1: 134,077,133 (GRCm39) R312I probably benign Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dock10 T G 1: 80,551,897 (GRCm39) Y659S probably benign Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dsg2 G A 18: 20,724,937 (GRCm39) V448I probably benign Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
Efnb2 G T 8: 8,673,237 (GRCm39) T140K probably damaging Het
En1 A G 1: 120,531,350 (GRCm39) S197G unknown Het
Eogt T C 6: 97,090,825 (GRCm39) D438G probably damaging Het
Etnk2 A G 1: 133,291,661 (GRCm39) S54G probably benign Het
Etnk2 G T 1: 133,304,784 (GRCm39) A336S probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnppl A G 3: 130,414,398 (GRCm39) T98A probably damaging Het
Fam131b T G 6: 42,295,514 (GRCm39) Q221P possibly damaging Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam90a1a A G 8: 22,453,479 (GRCm39) N278S probably benign Het
Fbxo40 T A 16: 36,786,584 (GRCm39) M662L probably damaging Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fmo9 A T 1: 166,501,217 (GRCm39) F192L probably benign Het
Gabarap C T 11: 69,882,515 (GRCm39) probably benign Het
Gatad2a G T 8: 70,362,586 (GRCm39) H600N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Git2 T C 5: 114,877,185 (GRCm39) E99G probably damaging Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Glrx2 C T 1: 143,615,478 (GRCm39) A27V possibly damaging Het
Gm10961 T C 3: 107,540,310 (GRCm39) probably benign Het
Gpr25 G A 1: 136,188,448 (GRCm39) P55L probably benign Het
Gpsm3 G A 17: 34,809,728 (GRCm39) R52H possibly damaging Het
Grm7 G C 6: 111,335,256 (GRCm39) D556H probably damaging Het
Hdac5 A G 11: 102,091,342 (GRCm39) F683L probably benign Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Irx5 A C 8: 93,086,316 (GRCm39) E133A probably damaging Het
Itgb5 C T 16: 33,760,932 (GRCm39) T589I probably benign Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kcna5 A T 6: 126,510,823 (GRCm39) I435N probably damaging Het
Kcnj5 T C 9: 32,233,488 (GRCm39) I276V probably damaging Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Krt1c T C 15: 101,722,408 (GRCm39) R426G probably damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lin7b A T 7: 45,019,351 (GRCm39) H72Q probably benign Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Map3k9 A T 12: 81,769,000 (GRCm39) V1016E probably damaging Het
Mcam T C 9: 44,046,003 (GRCm39) L6P probably damaging Het
Mgam A G 6: 40,641,794 (GRCm39) H549R possibly damaging Het
Miip G A 4: 147,950,231 (GRCm39) P122S probably damaging Het
Mkrn1 T A 6: 39,377,390 (GRCm39) N282Y probably null Het
Mrc1 T C 2: 14,332,655 (GRCm39) V1285A probably benign Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mybpc1 T C 10: 88,406,430 (GRCm39) D152G probably damaging Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Myh7b A G 2: 155,467,592 (GRCm39) D739G possibly damaging Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Nfkbib A T 7: 28,461,480 (GRCm39) Y86N probably damaging Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Nrip1 G T 16: 76,089,778 (GRCm39) T593K probably benign Het
Obscn A G 11: 58,964,459 (GRCm39) Y726H probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or4f14b T C 2: 111,775,633 (GRCm39) H56R probably benign Het
Or8d2 T A 9: 38,760,268 (GRCm39) I286K probably damaging Het
Or8g32 T C 9: 39,305,518 (GRCm39) Y144H probably benign Het
Pard6g T A 18: 80,123,040 (GRCm39) F25I probably damaging Het
Parp6 C A 9: 59,540,821 (GRCm39) C291* probably null Het
Perm1 C T 4: 156,302,988 (GRCm39) R511* probably null Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Pole T A 5: 110,445,296 (GRCm39) L481Q probably damaging Het
Polr2i T C 7: 29,932,493 (GRCm39) C67R probably damaging Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Pramel31 G T 4: 144,088,295 (GRCm39) E30D probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptgfrn T C 3: 100,963,758 (GRCm39) N618S possibly damaging Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,287,721 (GRCm39) N352Y probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Rims1 C T 1: 22,416,753 (GRCm39) probably null Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Rnpep G C 1: 135,211,715 (GRCm39) A11G probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,145,250 (GRCm39) probably benign Het
Rsph4a T C 10: 33,787,632 (GRCm39) I596T probably damaging Het
Ryr2 A T 13: 11,715,257 (GRCm39) Y2770* probably null Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Sertad4 T C 1: 192,529,340 (GRCm39) T159A probably benign Het
Setd1a T A 7: 127,384,296 (GRCm39) Y382* probably null Het
Sfswap T A 5: 129,590,304 (GRCm39) V267E possibly damaging Het
Shank1 T A 7: 44,002,161 (GRCm39) D1293E possibly damaging Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc26a9 C A 1: 131,693,750 (GRCm39) R747S probably benign Het
Slc36a1 A G 11: 55,114,498 (GRCm39) D192G probably damaging Het
Slc4a4 T A 5: 89,280,273 (GRCm39) L366Q probably damaging Het
Sorcs1 T C 19: 50,216,747 (GRCm39) probably null Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Svep1 T A 4: 58,073,333 (GRCm39) Y1992F probably benign Het
Syce1l A G 8: 114,381,466 (GRCm39) R152G possibly damaging Het
Tbc1d17 A C 7: 44,494,555 (GRCm39) S227A probably damaging Het
Telo2 A T 17: 25,321,712 (GRCm39) probably null Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Tmem143 G A 7: 45,556,426 (GRCm39) D144N possibly damaging Het
Tmprss11a T A 5: 86,567,891 (GRCm39) I279F probably damaging Het
Tnc A G 4: 63,936,333 (GRCm39) L201P probably damaging Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Ttn A G 2: 76,619,245 (GRCm39) probably null Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Unc80 G A 1: 66,722,432 (GRCm39) M3015I probably benign Het
Usp9y A T Y: 1,367,093 (GRCm39) V998D probably benign Het
Utrn A G 10: 12,339,083 (GRCm39) F2858S probably damaging Het
Vmn1r224 T C 17: 20,639,447 (GRCm39) I8T probably benign Het
Vmn2r107 T C 17: 20,576,775 (GRCm39) S258P possibly damaging Het
Wars1 A C 12: 108,841,667 (GRCm39) F160C probably damaging Het
Xirp1 T G 9: 120,016,907 (GRCm38) Q970P probably benign Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zc3h11a C T 1: 133,552,359 (GRCm39) V583I probably benign Het
Zfp28 A T 7: 6,397,791 (GRCm39) Y742F probably damaging Het
Zfp541 A G 7: 15,811,898 (GRCm39) T184A probably damaging Het
Zfp623 T C 15: 75,819,760 (GRCm39) S239P probably damaging Het
Zfp804b T C 5: 6,821,938 (GRCm39) D375G probably damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAGCCAGCCTTGGACTTCTAC -3'
(R):5'- GGCTGTTCTGCCGAAGAGAAACTG -3'

Sequencing Primer
(F):5'- TTGGACTTCTACAGCAAGCC -3'
(R):5'- GCAAGGGAGGGGCATCC -3'
Posted On 2014-05-23