Mutagenetix > Incidental Mutation

Incidental Mutation 'R8997:Pik3c2b'

684749

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R8997 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133090779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 988 (E988G)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077730
AA Change: E988G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: E988G

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 98.1%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Abhd17a	T	C	10: 80,586,636	T71A	probably benign	Het
Adgrv1	GTT	GT	13: 81,405,338		probably null	Het
Adra2a	T	C	19: 54,047,298	S362P	probably benign	Het
Arid1a	T	A	4: 133,694,032	N436Y	unknown	Het
Cma2	T	A	14: 55,972,744	C85S	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Cntn3	A	G	6: 102,204,062	V724A	probably damaging	Het
Dennd1a	C	T	2: 37,800,485	G868R	probably benign	Het
Disp2	C	T	2: 118,786,986	P154S	probably damaging	Het
Dlgap1	A	G	17: 70,516,533	D171G	possibly damaging	Het
Dpp4	A	C	2: 62,334,614	I697S	probably damaging	Het
Dync2h1	A	T	9: 7,129,003	D1837E	probably benign	Het
Fbxo39	T	A	11: 72,317,640	S273T	probably damaging	Het
Fgf5	A	T	5: 98,275,552	*265C	probably null	Het
Fscb	A	G	12: 64,473,984	V236A	possibly damaging	Het
Gm21731	A	T	13: 120,240,979	M104L	probably benign	Het
Greb1l	A	T	18: 10,510,747	T614S	probably damaging	Het
Gtdc1	A	T	2: 44,825,374	N52K	probably benign	Het
Il6ra	T	C	3: 89,887,111	D181G	probably damaging	Het
Inhba	T	G	13: 16,026,522	V223G	possibly damaging	Het
Kcnma1	T	C	14: 23,462,969		probably benign	Het
Kdm2b	C	A	5: 122,880,173	W1068L	probably null	Het
Mdn1	T	C	4: 32,773,275	L5485P	probably damaging	Het
Muc16	T	C	9: 18,607,467		probably benign	Het
Ncapd3	T	C	9: 27,048,281	F338L	probably damaging	Het
Negr1	T	A	3: 157,016,281	I164N	probably damaging	Het
Nek9	A	T	12: 85,320,791	C369S	probably benign	Het
Ninl	C	T	2: 150,959,896	E151K	probably damaging	Het
Nphp1	A	T	2: 127,754,062	S494R	possibly damaging	Het
Nphp4	G	A	4: 152,538,888	R673H	probably damaging	Het
Obscn	C	T	11: 59,043,803		probably benign	Het
Osbpl8	T	C	10: 111,255,714	S82P	probably benign	Het
Papd5	T	A	8: 88,252,395	V508D	probably benign	Het
Pcdhgb1	C	A	18: 37,681,080	P208Q	probably damaging	Het
Rfc1	A	T	5: 65,275,721	M722K	probably damaging	Het
Rnf111	A	T	9: 70,476,263	N129K	probably damaging	Het
Sdccag8	C	A	1: 176,955,808	L628I	probably damaging	Het
Sgcz	G	T	8: 38,660,740	D8E	probably benign	Het
Sgip1	T	A	4: 102,933,584	F254L		Het
Shf	A	G	2: 122,357,247	L26P	probably damaging	Het
Slc39a5	G	A	10: 128,396,479	A484V	probably damaging	Het
Slco4c1	T	A	1: 96,867,947	I129F	probably damaging	Het
Tbck	A	T	3: 132,734,345		probably null	Het
Teddm3	A	T	16: 21,152,937	V294E	probably damaging	Het
Treml1	A	T	17: 48,360,438	H117L	probably damaging	Het
Trip12	G	T	1: 84,793,875	T184N	probably benign	Het
Tuba3b	G	T	6: 145,621,228	M398I	possibly damaging	Het
Vcam1	T	C	3: 116,117,328	I474V	probably benign	Het
Wdsub1	A	C	2: 59,858,633	M415R	probably damaging	Het
Zfp14	A	T	7: 30,038,175	F462I	probably damaging	Het
Zfp846	G	A	9: 20,594,430	V529I	probably benign	Het
Zfp873	A	G	10: 82,061,156	T574A	probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATTTTACCCTGAAGCATGGGG -3'
(R):5'- AGTTTCTAAACGGGACACTTGC -3'

Sequencing Primer
(F):5'- GAGCTTTCTGAATCGAGGTATCAAG -3'
(R):5'- CACTTGCAAGGTGTAAAACTCCTGG -3'

Posted On

2021-10-11