Mutagenetix > Incidental Mutation

Incidental Mutation 'R7916:Pik3c2b'

648054

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R7916 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 133100904 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1377 (I1377N)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably benign
Transcript: ENSMUST00000077730
AA Change: I1377N

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: I1377N

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,864,590	L195*	probably null	Het
Ahnak	T	G	19: 9,005,832	D1493E	possibly damaging	Het
Alox12e	C	A	11: 70,321,285	R162L	probably benign	Het
Bax	T	G	7: 45,466,115	Q32P	probably benign	Het
BC003331	C	T	1: 150,384,498	R123K	probably benign	Het
Cand1	A	G	10: 119,216,588	M204T	probably benign	Het
Chd9	T	A	8: 91,035,056	Y2256*	probably null	Het
Chuk	A	G	19: 44,096,981	I242T	probably damaging	Het
Cic	T	C	7: 25,288,290	S1468P	probably damaging	Het
Col27a1	A	G	4: 63,224,552	H159R	probably damaging	Het
Cux1	T	C	5: 136,282,961	K1174E	probably damaging	Het
Dnah2	C	A	11: 69,421,148		probably null	Het
Dpp3	C	A	19: 4,917,024	E351*	probably null	Het
Dyrk1a	A	G	16: 94,673,341	Y319C	probably damaging	Het
E130308A19Rik	T	C	4: 59,719,841	S458P	probably damaging	Het
Ehmt1	G	A	2: 24,856,696	L425F	probably damaging	Het
Emp2	C	A	16: 10,284,573	R125L	possibly damaging	Het
Farsb	A	G	1: 78,458,563		probably null	Het
Frk	A	T	10: 34,484,025	R7S	possibly damaging	Het
Glb1l2	T	C	9: 26,767,424	T483A	probably benign	Het
Gm5773	T	C	3: 93,773,279	V86A	possibly damaging	Het
Gm7324	T	G	14: 43,714,546	D215E	probably benign	Het
Gng13	A	T	17: 25,718,958	K44*	probably null	Het
Gprin1	C	T	13: 54,739,450	G337D	possibly damaging	Het
Ighv1-84	G	T	12: 115,980,989	Q22K	probably benign	Het
Il20rb	T	C	9: 100,466,251	H210R	probably benign	Het
Iqcm	C	T	8: 75,577,950	S113L	probably benign	Het
Kat6b	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	14: 21,662,349		probably benign	Het
Kmo	G	T	1: 175,659,670	G430W	probably damaging	Het
Kti12	A	C	4: 108,848,246	E119A	probably benign	Het
Kti12	G	T	4: 108,848,247	E119D	probably benign	Het
Ldhd	T	G	8: 111,629,391	D120A	possibly damaging	Het
Lyst	T	C	13: 13,647,072	S1344P	possibly damaging	Het
Mb	T	A	15: 77,016,057	I112F	probably damaging	Het
Mbd5	G	A	2: 49,257,106	V443M	probably damaging	Het
Milr1	A	G	11: 106,763,862	K180R	possibly damaging	Het
Mst1r	T	C	9: 107,907,578	F145S	probably damaging	Het
Mthfd2	A	T	6: 83,309,473	I251K	possibly damaging	Het
Nfx1	T	A	4: 40,977,142	M272K	probably benign	Het
Nlrp3	A	G	11: 59,551,863	D747G	probably benign	Het
Olfr1049	A	T	2: 86,254,858	Y278*	probably null	Het
Olfr1385	A	T	11: 49,494,716	Y61F	probably benign	Het
Olfr484	C	A	7: 108,125,122	S47I	possibly damaging	Het
Pcdha11	A	G	18: 37,007,388	E690G	probably benign	Het
Pcdhga4	T	A	18: 37,685,449	I17N	probably benign	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phf20	A	G	2: 156,287,938	K477E	probably damaging	Het
Polr3h	T	C	15: 81,922,412	K69E	probably benign	Het
Rpgrip1	A	G	14: 52,131,184	H280R	possibly damaging	Het
Rpp40	C	A	13: 35,902,051	R132L	probably benign	Het
Ryr1	G	A	7: 29,090,939	Q1488*	probably null	Het
Sh3bp1	A	G	15: 78,907,221	M403V	probably benign	Het
Slc20a1	G	A	2: 129,207,837	D340N	probably benign	Het
Snrnp200	T	A	2: 127,233,059	N1517K	possibly damaging	Het
Srek1ip1	T	A	13: 104,837,473	H129Q	possibly damaging	Het
Thumpd2	A	T	17: 81,026,687	C491S	probably benign	Het
Tle3	A	T	9: 61,407,128	N204I	probably benign	Het
Tmem131	A	G	1: 36,823,086	V677A	probably benign	Het
Topaz1	T	G	9: 122,747,434	L30R	probably benign	Het
Trim35	T	A	14: 66,308,860	C359S	probably damaging	Het
Ttn	A	C	2: 76,944,521	V2105G	unknown	Het
Ube2o	A	G	11: 116,581,058	V119A	probably benign	Het
Ubr2	A	T	17: 46,968,382		probably null	Het
Uhmk1	A	G	1: 170,205,188	V347A	possibly damaging	Het
Utp4	C	T	8: 106,922,865	P649S	probably damaging	Het
Vmn2r28	G	A	7: 5,480,819	T794I	probably damaging	Het
Vmn2r61	T	G	7: 42,300,511	F785C	probably damaging	Het
Xpot	C	A	10: 121,622,943		probably benign	Het
Zfp729a	C	T	13: 67,620,175	R645H	probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGTTGATTGAGTCCAGCCTG -3'
(R):5'- ATTACCAACCAGTTCAGCGGC -3'

Sequencing Primer
(F):5'- CAGCCTGGGCAGCGTAG -3'
(R):5'- CTTTAATGCAGGTCACATCAGCGAG -3'

Posted On

2020-09-15