Incidental Mutation 'R6223:Pik3c2b'
ID 504118
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 044354-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.219) question?
Stock # R6223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 132998095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 324 (L324M)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: L324M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: L324M

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145153
Predicted Effect probably benign
Transcript: ENSMUST00000153707
SMART Domains Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186515
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,269,873 (GRCm39) R8S probably benign Het
Abca8b A G 11: 109,868,672 (GRCm39) V164A probably benign Het
Acadm C A 3: 153,644,186 (GRCm39) probably null Het
Ap3b2 G A 7: 81,123,210 (GRCm39) R435* probably null Het
Art2b A G 7: 101,229,158 (GRCm39) F247S possibly damaging Het
C1rb T A 6: 124,551,539 (GRCm39) D216E probably benign Het
Casz1 C A 4: 149,017,840 (GRCm39) D90E probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdc25a C A 9: 109,718,842 (GRCm39) P409T possibly damaging Het
Cidea A C 18: 67,491,809 (GRCm39) K23T possibly damaging Het
Clspn T A 4: 126,479,961 (GRCm39) D1101E probably damaging Het
Col10a1 A T 10: 34,271,183 (GRCm39) D385V probably damaging Het
Crat C T 2: 30,297,042 (GRCm39) V304I probably benign Het
Cyp2d26 A T 15: 82,675,918 (GRCm39) W265R probably benign Het
Dock8 A T 19: 25,138,416 (GRCm39) Y1247F probably benign Het
Dync2i1 T C 12: 116,221,078 (GRCm39) D11G possibly damaging Het
Eed A G 7: 89,605,495 (GRCm39) Y365H probably damaging Het
Fabp5 T A 3: 10,080,170 (GRCm39) F73L probably benign Het
Fbn1 C T 2: 125,254,591 (GRCm39) C224Y possibly damaging Het
Ggcx T C 6: 72,406,588 (GRCm39) F684L probably damaging Het
Glrp1 G A 1: 88,431,164 (GRCm39) Q69* probably null Het
Gm29797 T C 2: 181,300,850 (GRCm39) V115A possibly damaging Het
Gtf3c1 C T 7: 125,275,797 (GRCm39) R543K probably benign Het
Ifih1 T C 2: 62,428,603 (GRCm39) I891V probably benign Het
Ifnar2 C T 16: 91,184,876 (GRCm39) T89M probably damaging Het
Kat6a C A 8: 23,430,442 (GRCm39) N1932K unknown Het
Mgat5 A T 1: 127,310,716 (GRCm39) D210V possibly damaging Het
Mmel1 A G 4: 154,956,159 (GRCm39) probably null Het
Myh3 G T 11: 66,988,843 (GRCm39) V1499L probably benign Het
Ncan A C 8: 70,562,604 (GRCm39) D551E probably benign Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Olfml3 G A 3: 103,643,776 (GRCm39) R202W probably damaging Het
Or2w4 G A 13: 21,795,536 (GRCm39) T201I probably benign Het
Or4e2 A G 14: 52,688,136 (GRCm39) R89G probably benign Het
Pcdh9 T C 14: 93,253,169 (GRCm39) K1131E probably benign Het
Pcolce A G 5: 137,603,561 (GRCm39) M424T probably damaging Het
Pi16 C A 17: 29,546,413 (GRCm39) S397* probably null Het
Pi4ka A T 16: 17,175,435 (GRCm39) Y464* probably null Het
Prdm2 T C 4: 142,868,777 (GRCm39) N179S probably benign Het
Prss56 C T 1: 87,113,134 (GRCm39) P183S probably benign Het
Prx T G 7: 27,216,261 (GRCm39) M393R probably damaging Het
Qpctl T C 7: 18,877,134 (GRCm39) D328G probably damaging Het
Qser1 A G 2: 104,617,993 (GRCm39) S940P probably benign Het
Rchy1 G A 5: 92,105,826 (GRCm39) R41W probably damaging Het
Scp2d1 T C 2: 144,665,868 (GRCm39) I69T possibly damaging Het
Sirpb1a A G 3: 15,444,086 (GRCm39) V388A probably benign Het
Ssu2 G T 6: 112,353,409 (GRCm39) C238* probably null Het
Stub1 C T 17: 26,051,787 (GRCm39) G14D probably damaging Het
Tab1 T A 15: 80,032,464 (GRCm39) C24S probably damaging Het
Tdrd1 T C 19: 56,854,282 (GRCm39) V1076A probably damaging Het
Tex10 T C 4: 48,468,525 (GRCm39) R134G probably damaging Het
Tg T A 15: 66,579,771 (GRCm39) N1525K probably benign Het
Tll2 G A 19: 41,124,391 (GRCm39) T208I possibly damaging Het
Tmem232 T C 17: 65,807,191 (GRCm39) M1V probably null Het
Ttc7b A G 12: 100,353,368 (GRCm39) probably null Het
Ubb A G 11: 62,443,351 (GRCm39) E127G possibly damaging Het
Ulk2 A T 11: 61,678,330 (GRCm39) Y796* probably null Het
Vdac2 G A 14: 21,895,246 (GRCm39) G265R possibly damaging Het
Vmn2r45 A T 7: 8,486,301 (GRCm39) V329E probably benign Het
Zbtb47 G A 9: 121,592,853 (GRCm39) R391Q possibly damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCTGTTCTTAGCCCAGG -3'
(R):5'- TCTAGAGACCTGGAATCCTCC -3'

Sequencing Primer
(F):5'- CCTAGGTTGGCAGGTAATGTATTTC -3'
(R):5'- TCCAGCATGTGGCAGAA -3'
Posted On 2018-02-28